Incidental Mutation 'R2877:Ncapd3'
ID260617
Institutional Source Beutler Lab
Gene Symbol Ncapd3
Ensembl Gene ENSMUSG00000035024
Gene Namenon-SMC condensin II complex, subunit D3
Synonyms4632407J06Rik, B130055D15Rik, 2810487N22Rik
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27030175-27095315 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 27044487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
Predicted Effect probably null
Transcript: ENSMUST00000073127
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000073127
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086198
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000216677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217311
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Ncapd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Ncapd3 APN 9 27052353 missense probably benign
IGL00544:Ncapd3 APN 9 27063338 missense possibly damaging 0.94
IGL01657:Ncapd3 APN 9 27071824 missense possibly damaging 0.81
IGL01979:Ncapd3 APN 9 27071965 critical splice donor site probably null
IGL02073:Ncapd3 APN 9 27063316 missense probably benign 0.03
IGL02083:Ncapd3 APN 9 27051821 missense probably damaging 1.00
IGL02383:Ncapd3 APN 9 27050328 missense probably benign 0.44
IGL02429:Ncapd3 APN 9 27089302 missense probably benign 0.08
IGL02437:Ncapd3 APN 9 27063968 splice site probably benign
IGL02861:Ncapd3 APN 9 27069899 missense probably benign 0.00
IGL03202:Ncapd3 APN 9 27071715 splice site probably benign
IGL03219:Ncapd3 APN 9 27063873 splice site probably benign
IGL03252:Ncapd3 APN 9 27051449 missense probably damaging 1.00
pevensie UTSW 9 27086046 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0084:Ncapd3 UTSW 9 27056111 missense probably damaging 0.98
R0491:Ncapd3 UTSW 9 27057883 missense probably damaging 0.97
R0513:Ncapd3 UTSW 9 27064105 splice site probably benign
R0565:Ncapd3 UTSW 9 27087998 missense probably benign 0.00
R0601:Ncapd3 UTSW 9 27041507 missense probably benign 0.05
R0671:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0673:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0842:Ncapd3 UTSW 9 27037084 missense probably benign 0.01
R1178:Ncapd3 UTSW 9 27041421 missense probably benign
R1366:Ncapd3 UTSW 9 27057940 missense probably damaging 1.00
R1432:Ncapd3 UTSW 9 27069872 splice site probably benign
R1439:Ncapd3 UTSW 9 27087566 critical splice donor site probably null
R1532:Ncapd3 UTSW 9 27083360 nonsense probably null
R2131:Ncapd3 UTSW 9 27083346 missense probably damaging 0.98
R2178:Ncapd3 UTSW 9 27088549 missense probably benign 0.01
R2238:Ncapd3 UTSW 9 27067024 missense probably benign
R2258:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2259:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2260:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2297:Ncapd3 UTSW 9 27041501 nonsense probably null
R3612:Ncapd3 UTSW 9 27050357 missense probably damaging 1.00
R3709:Ncapd3 UTSW 9 27052349 missense probably benign 0.00
R3791:Ncapd3 UTSW 9 27052635 missense probably benign 0.27
R4052:Ncapd3 UTSW 9 27089383 splice site probably null
R4297:Ncapd3 UTSW 9 27052327 missense probably benign
R4299:Ncapd3 UTSW 9 27052327 missense probably benign
R4441:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R4572:Ncapd3 UTSW 9 27094615 missense probably damaging 1.00
R4675:Ncapd3 UTSW 9 27094742 unclassified probably benign
R4790:Ncapd3 UTSW 9 27051850 missense probably benign 0.00
R4835:Ncapd3 UTSW 9 27086046 missense probably damaging 1.00
R4919:Ncapd3 UTSW 9 27051775 missense possibly damaging 0.95
R4928:Ncapd3 UTSW 9 27071735 nonsense probably null
R4939:Ncapd3 UTSW 9 27063869 critical splice donor site probably null
R4980:Ncapd3 UTSW 9 27063295 missense probably damaging 0.99
R5030:Ncapd3 UTSW 9 27071766 missense probably damaging 0.98
R5052:Ncapd3 UTSW 9 27051719 missense probably damaging 1.00
R5180:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5343:Ncapd3 UTSW 9 27088053 small deletion probably benign
R5656:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5840:Ncapd3 UTSW 9 27094758 missense probably benign 0.00
R5900:Ncapd3 UTSW 9 27066969 missense probably benign 0.26
R6093:Ncapd3 UTSW 9 27056158 missense probably damaging 0.99
R6122:Ncapd3 UTSW 9 27063982 missense probably benign 0.00
R6249:Ncapd3 UTSW 9 27088053 small deletion probably benign
R6428:Ncapd3 UTSW 9 27052664 splice site probably null
R6432:Ncapd3 UTSW 9 27044509 missense probably damaging 0.98
R6441:Ncapd3 UTSW 9 27063416 missense probably benign 0.03
R6459:Ncapd3 UTSW 9 27051755 missense probably benign 0.00
R6567:Ncapd3 UTSW 9 27067004 missense possibly damaging 0.83
R6722:Ncapd3 UTSW 9 27087556 missense probably benign
R6862:Ncapd3 UTSW 9 27030809 missense probably damaging 0.98
R7234:Ncapd3 UTSW 9 27050359 missense probably damaging 0.97
R7286:Ncapd3 UTSW 9 27069958 missense probably damaging 1.00
R7404:Ncapd3 UTSW 9 27067019 missense probably benign 0.01
R7541:Ncapd3 UTSW 9 27067040 missense probably damaging 0.99
R7583:Ncapd3 UTSW 9 27071848 missense probably damaging 1.00
R7655:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7656:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7815:Ncapd3 UTSW 9 27063440 nonsense probably null
R7876:Ncapd3 UTSW 9 27045223 critical splice donor site probably null
R7913:Ncapd3 UTSW 9 27048226 nonsense probably null
R8068:Ncapd3 UTSW 9 27063361 missense possibly damaging 0.66
R8147:Ncapd3 UTSW 9 27030718 start gained probably benign
R8197:Ncapd3 UTSW 9 27086033 missense probably damaging 0.98
R8264:Ncapd3 UTSW 9 27094742 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCACTGAAGGCTCACGG -3'
(R):5'- ACCTGATAATCCTCTTTTCTAGGTGG -3'

Sequencing Primer
(F):5'- TAGAGATCCCATGTCTGCCTGAG -3'
(R):5'- ATAATCCTCTTTTCTAGGTGGTTTTC -3'
Posted On2015-01-23