Incidental Mutation 'R2877:Nat6'
ID260619
Institutional Source Beutler Lab
Gene Symbol Nat6
Ensembl Gene ENSMUSG00000079334
Gene NameN-acetyltransferase 6
Synonyms
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107578887-107584050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107583168 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 87 (E87D)
Ref Sequence ENSEMBL: ENSMUSP00000122321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010192] [ENSMUST00000010195] [ENSMUST00000040059] [ENSMUST00000093785] [ENSMUST00000112387] [ENSMUST00000122985] [ENSMUST00000123005] [ENSMUST00000127380] [ENSMUST00000130053] [ENSMUST00000139274] [ENSMUST00000139581] [ENSMUST00000144392] [ENSMUST00000148440] [ENSMUST00000149638] [ENSMUST00000149487] [ENSMUST00000195725]
Predicted Effect probably benign
Transcript: ENSMUST00000010192
SMART Domains Protein: ENSMUSP00000010192
Gene: ENSMUSG00000010048

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:IFRD 31 340 7.3e-101 PFAM
Pfam:IFRD_C 385 438 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010195
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040059
SMART Domains Protein: ENSMUSP00000042667
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 354 4.8e-122 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093785
AA Change: E87D

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091300
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 4.95e-7 PROSPERO
internal_repeat_1 40 99 4.95e-7 PROSPERO
Pfam:Acetyltransf_1 144 217 2.1e-12 PFAM
Pfam:Acetyltransf_7 147 218 9.5e-9 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 261 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112387
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000122985
AA Change: E87D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122807
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123005
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127380
AA Change: E87D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116378
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130053
AA Change: E87D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114490
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139274
SMART Domains Protein: ENSMUSP00000138933
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139581
AA Change: E87D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122321
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144392
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194932
Predicted Effect probably benign
Transcript: ENSMUST00000148440
SMART Domains Protein: ENSMUSP00000119499
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 355 2.6e-127 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149638
SMART Domains Protein: ENSMUSP00000139004
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149487
SMART Domains Protein: ENSMUSP00000117845
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 301 4.9e-103 PFAM
Pfam:Glyco_hydro_56 291 325 6.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195725
SMART Domains Protein: ENSMUSP00000141718
Gene: ENSMUSG00000010048

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:IFRD 32 139 5.7e-28 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Nat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Nat6 APN 9 107583599 missense probably benign 0.01
R1838:Nat6 UTSW 9 107583017 missense possibly damaging 0.49
R1839:Nat6 UTSW 9 107583017 missense possibly damaging 0.49
R2878:Nat6 UTSW 9 107583168 missense possibly damaging 0.85
R3688:Nat6 UTSW 9 107583350 missense possibly damaging 0.83
R4836:Nat6 UTSW 9 107583539 missense probably damaging 1.00
R4873:Nat6 UTSW 9 107583619 missense probably damaging 0.97
R4875:Nat6 UTSW 9 107583619 missense probably damaging 0.97
R6029:Nat6 UTSW 9 107583554 missense probably damaging 1.00
R6893:Nat6 UTSW 9 107583026 missense probably damaging 0.96
R7278:Nat6 UTSW 9 107583299 missense probably damaging 1.00
R7294:Nat6 UTSW 9 107582983 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAGATTCAACCTGTCCAAGCTAAC -3'
(R):5'- GGTCTAGTACCCGTGATAAGC -3'

Sequencing Primer
(F):5'- GTCCAAGCTAACCCTGGATCCTG -3'
(R):5'- CCGTGATAAGCGGGCATG -3'
Posted On2015-01-23