Mutagenetix > Incidental Mutation

Incidental Mutation 'R2877:Chd3'

260630

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1

MMRRC Submission

040465-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2877 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69234099-69260232 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 69251998 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 87 (C87*)

Ref Sequence

ENSEMBL: ENSMUSP00000121192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]

AlphaFold

B1AR17

Predicted Effect

probably null
Transcript: ENSMUST00000092971
AA Change: C435*

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: C435*

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108661
AA Change: C435*

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: C435*

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000128981
AA Change: C341*

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: C341*

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000144701
AA Change: C85*

SMART Domains

Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474
AA Change: C85*

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	23	32	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
PHD	84	127	1.54e-14	SMART
RING	85	126	4.25e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151436

SMART Domains

Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	142	9e-24	PFAM
SCOP:d1gkub2	162	197	1e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000154046
AA Change: C87*

SMART Domains

Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474
AA Change: C87*

Domain	Start	End	E-Value	Type
low complexity region	1	29	N/A	INTRINSIC
low complexity region	50	66	N/A	INTRINSIC
PHD	86	129	1.54e-14	SMART
RING	87	128	4.25e-1	SMART

Meta Mutation Damage Score

0.9711

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

96% (66/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	C	5: 109,886,811 (GRCm39)		probably benign	Het
Abca13	C	T	11: 9,241,889 (GRCm39)	L1251F	possibly damaging	Het
Accsl	A	T	2: 93,689,755 (GRCm39)	M384K	probably damaging	Het
Adss1	A	C	12: 112,600,623 (GRCm39)	K197N	probably damaging	Het
Alg11	A	G	8: 22,555,374 (GRCm39)	N170D	possibly damaging	Het
Ambn	T	C	5: 88,608,559 (GRCm39)		probably benign	Het
Anapc7	T	C	5: 122,566,219 (GRCm39)	Y43H	probably benign	Het
Anxa10	T	A	8: 62,513,373 (GRCm39)	I255F	probably damaging	Het
Atg2b	A	T	12: 105,630,268 (GRCm39)	Y374*	probably null	Het
Axl	T	A	7: 25,465,949 (GRCm39)	M563L	probably damaging	Het
Carmil2	A	G	8: 106,422,055 (GRCm39)	E1108G	probably damaging	Het
Casp1	T	C	9: 5,303,110 (GRCm39)	M188T	probably damaging	Het
Col6a3	G	A	1: 90,703,321 (GRCm39)	T2475I	unknown	Het
Creb3l4	A	T	3: 90,149,615 (GRCm39)	S83R	probably damaging	Het
Cyp2a4	G	A	7: 26,011,612 (GRCm39)	E278K	possibly damaging	Het
Dync1li2	A	C	8: 105,156,047 (GRCm39)	Y265D	probably damaging	Het
Eif3f	G	A	7: 108,534,019 (GRCm39)		probably null	Het
Eipr1	C	T	12: 28,810,091 (GRCm39)	T22I	possibly damaging	Het
Fbxo48	A	G	11: 16,903,382 (GRCm39)	K3E	possibly damaging	Het
Fbxw13	A	G	9: 109,010,534 (GRCm39)	F368S	probably damaging	Het
Fbxw19	A	T	9: 109,315,038 (GRCm39)	W175R	probably damaging	Het
Fibcd1	G	A	2: 31,728,678 (GRCm39)	P60S	probably benign	Het
Foxa3	A	T	7: 18,748,805 (GRCm39)	M107K	probably benign	Het
Foxj2	G	A	6: 122,819,791 (GRCm39)	D560N	probably damaging	Het
Gfm2	A	G	13: 97,289,757 (GRCm39)	R181G	possibly damaging	Het
Gpr25	C	T	1: 136,188,553 (GRCm39)	G20D	possibly damaging	Het
Grin1	A	G	2: 25,187,641 (GRCm39)	V594A	probably damaging	Het
Itpripl1	A	G	2: 126,983,534 (GRCm39)	V196A	probably benign	Het
Kcns1	A	G	2: 164,006,682 (GRCm39)	I427T	probably damaging	Het
Kiz	T	C	2: 146,731,476 (GRCm39)	V322A	possibly damaging	Het
Mslnl	G	A	17: 25,961,908 (GRCm39)	V128M	probably damaging	Het
Muc19	T	A	15: 91,777,200 (GRCm39)		noncoding transcript	Het
Naa16	A	G	14: 79,580,738 (GRCm39)	M592T	probably benign	Het
Naa80	A	T	9: 107,460,367 (GRCm39)	E87D	possibly damaging	Het
Ncapd3	T	A	9: 26,955,783 (GRCm39)		probably null	Het
Nebl	C	A	2: 17,439,740 (GRCm39)	D178Y	probably damaging	Het
Nedd1	T	A	10: 92,549,988 (GRCm39)	N99I	possibly damaging	Het
Nuak1	T	C	10: 84,211,209 (GRCm39)	D293G	possibly damaging	Het
Or5b123	A	T	19: 13,596,996 (GRCm39)	I157F	probably damaging	Het
Or5m9b	T	C	2: 85,905,675 (GRCm39)	M197T	possibly damaging	Het
Palb2	A	G	7: 121,713,652 (GRCm39)	V877A	probably damaging	Het
Rassf6	C	T	5: 90,754,664 (GRCm39)	V205I	probably damaging	Het
Rbak	A	G	5: 143,159,860 (GRCm39)	Y398H	probably damaging	Het
Rcbtb1	A	G	14: 59,448,041 (GRCm39)		probably benign	Het
Robo4	CGG	CG	9: 37,322,786 (GRCm39)		probably null	Het
Smpdl3a	C	A	10: 57,685,181 (GRCm39)	T317K	probably damaging	Het
Speer4e1	C	T	5: 14,987,130 (GRCm39)	V92M	probably damaging	Het
Syne2	A	G	12: 76,047,605 (GRCm39)	I4009V	probably benign	Het
Tarbp1	G	A	8: 127,154,571 (GRCm39)	L1474F	probably damaging	Het
Tchh	A	G	3: 93,351,535 (GRCm39)	E325G	unknown	Het
Trpc4	T	C	3: 54,198,761 (GRCm39)	S562P	probably damaging	Het
Ttn	T	C	2: 76,567,409 (GRCm39)	D27828G	probably damaging	Het
Ulk4	T	C	9: 121,089,105 (GRCm39)	D258G	probably benign	Het
Vmn1r215	A	G	13: 23,260,731 (GRCm39)	H257R	probably benign	Het
Vmn2r56	A	C	7: 12,444,954 (GRCm39)	M433R	probably benign	Het
Vmn2r76	C	A	7: 85,875,201 (GRCm39)	C592F	probably benign	Het
Zcchc8	C	T	5: 123,838,766 (GRCm39)	V591I	probably benign	Het
Znhit6	G	C	3: 145,282,409 (GRCm39)	G96A	probably benign	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69,247,888 (GRCm39)	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69,237,455 (GRCm39)	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69,248,209 (GRCm39)	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69,240,697 (GRCm39)	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69,250,791 (GRCm39)	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69,248,557 (GRCm39)	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69,244,037 (GRCm39)	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69,250,806 (GRCm39)	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69,239,568 (GRCm39)	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69,249,060 (GRCm39)	unclassified	probably benign
IGL01635:Chd3	APN	11	69,252,076 (GRCm39)	splice site	probably benign
IGL01942:Chd3	APN	11	69,240,931 (GRCm39)	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69,248,319 (GRCm39)	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69,251,501 (GRCm39)	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69,251,886 (GRCm39)	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69,250,655 (GRCm39)	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69,242,920 (GRCm39)	unclassified	probably benign
IGL02415:Chd3	APN	11	69,239,739 (GRCm39)	splice site	probably benign
IGL02648:Chd3	APN	11	69,242,976 (GRCm39)	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69,251,874 (GRCm39)	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69,245,230 (GRCm39)	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69,252,022 (GRCm39)	nonsense	probably null
IGL03168:Chd3	APN	11	69,239,741 (GRCm39)	splice site	probably benign
IGL03327:Chd3	APN	11	69,241,012 (GRCm39)	missense	probably damaging	1.00
burg	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
castello	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
feste	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
Fortress	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
moat	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
Redoubt	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
schloss	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
siege	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69,250,739 (GRCm39)	unclassified	probably benign
R0129:Chd3	UTSW	11	69,239,327 (GRCm39)	nonsense	probably null
R0130:Chd3	UTSW	11	69,250,656 (GRCm39)	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69,247,159 (GRCm39)	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69,248,367 (GRCm39)	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69,244,931 (GRCm39)	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69,252,495 (GRCm39)	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69,236,313 (GRCm39)	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69,238,021 (GRCm39)	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69,248,400 (GRCm39)	splice site	probably null
R1484:Chd3	UTSW	11	69,250,725 (GRCm39)	missense	probably benign	0.17
R1741:Chd3	UTSW	11	69,246,480 (GRCm39)	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69,255,523 (GRCm39)	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
R1833:Chd3	UTSW	11	69,244,949 (GRCm39)	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69,239,878 (GRCm39)	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69,239,877 (GRCm39)	missense	probably benign
R2147:Chd3	UTSW	11	69,239,854 (GRCm39)	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69,251,471 (GRCm39)	missense	probably damaging	1.00
R2879:Chd3	UTSW	11	69,254,924 (GRCm39)	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69,251,442 (GRCm39)	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69,252,973 (GRCm39)	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
R3845:Chd3	UTSW	11	69,237,585 (GRCm39)	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69,239,827 (GRCm39)	missense	probably benign
R4115:Chd3	UTSW	11	69,248,343 (GRCm39)	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69,240,703 (GRCm39)	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69,244,035 (GRCm39)	nonsense	probably null
R4622:Chd3	UTSW	11	69,239,834 (GRCm39)	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4635:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4859:Chd3	UTSW	11	69,250,722 (GRCm39)	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69,245,034 (GRCm39)	unclassified	probably benign
R5173:Chd3	UTSW	11	69,260,069 (GRCm39)	unclassified	probably benign
R5287:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5403:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5511:Chd3	UTSW	11	69,252,301 (GRCm39)	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69,244,177 (GRCm39)	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69,252,261 (GRCm39)	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69,242,944 (GRCm39)	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69,240,063 (GRCm39)	missense	probably benign
R6211:Chd3	UTSW	11	69,243,503 (GRCm39)	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69,236,361 (GRCm39)	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69,244,604 (GRCm39)	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69,252,510 (GRCm39)	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69,254,857 (GRCm39)	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69,243,371 (GRCm39)	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69,240,938 (GRCm39)	nonsense	probably null
R6548:Chd3	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
R6582:Chd3	UTSW	11	69,259,982 (GRCm39)	unclassified	probably benign
R6721:Chd3	UTSW	11	69,260,045 (GRCm39)	unclassified	probably benign
R6776:Chd3	UTSW	11	69,245,296 (GRCm39)	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69,260,027 (GRCm39)	missense	unknown
R7136:Chd3	UTSW	11	69,239,264 (GRCm39)	missense	probably null	0.37
R7164:Chd3	UTSW	11	69,253,132 (GRCm39)	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69,254,921 (GRCm39)	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69,260,037 (GRCm39)	missense	unknown
R7238:Chd3	UTSW	11	69,254,873 (GRCm39)	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69,236,394 (GRCm39)	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69,247,096 (GRCm39)	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69,248,692 (GRCm39)	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69,246,459 (GRCm39)	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69,244,064 (GRCm39)	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69,247,451 (GRCm39)	missense	probably benign	0.13
R8150:Chd3	UTSW	11	69,254,510 (GRCm39)	missense	probably benign	0.02
R8161:Chd3	UTSW	11	69,241,711 (GRCm39)	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69,251,483 (GRCm39)	missense	probably damaging	1.00
R8334:Chd3	UTSW	11	69,241,622 (GRCm39)	missense	probably damaging	1.00
R8423:Chd3	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
R8690:Chd3	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
R8828:Chd3	UTSW	11	69,247,097 (GRCm39)	missense	probably damaging	1.00
R8857:Chd3	UTSW	11	69,253,146 (GRCm39)	missense	probably benign	0.22
R9124:Chd3	UTSW	11	69,260,162 (GRCm39)	missense	unknown
R9170:Chd3	UTSW	11	69,241,648 (GRCm39)	missense	possibly damaging	0.64
R9213:Chd3	UTSW	11	69,255,628 (GRCm39)	missense	possibly damaging	0.53
R9285:Chd3	UTSW	11	69,249,954 (GRCm39)	missense	possibly damaging	0.64
R9293:Chd3	UTSW	11	69,244,027 (GRCm39)	missense	possibly damaging	0.94
R9368:Chd3	UTSW	11	69,251,200 (GRCm39)	missense	probably damaging	1.00
R9521:Chd3	UTSW	11	69,249,133 (GRCm39)	missense	probably benign	0.01
R9544:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
R9554:Chd3	UTSW	11	69,251,015 (GRCm39)	missense	probably damaging	1.00
R9588:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69,247,084 (GRCm39)	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
Z1186:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1186:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1187:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1187:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1188:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1188:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1189:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1189:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1190:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1190:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1191:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1191:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1192:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1192:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCTGAGAGGCCCAGAAAAC -3'
(R):5'- TGAGGACATCCCCTTGTGTGAG -3'

Sequencing Primer
(F):5'- TGAGAGGCCCAGAAAACCACAG -3'
(R):5'- GTGAGCCTCTCTGTGTGCC -3'

Posted On

2015-01-23