Incidental Mutation 'R2877:Eipr1'
ID260631
Institutional Source Beutler Lab
Gene Symbol Eipr1
Ensembl Gene ENSMUSG00000036613
Gene NameEARP complex and GARP complex interacting protein 1
SynonymsTssc1, D12Ertd604e
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location28751803-28869865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28760092 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 22 (T22I)
Ref Sequence ENSEMBL: ENSMUSP00000038845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035657] [ENSMUST00000221555] [ENSMUST00000221877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035657
AA Change: T22I

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038845
Gene: ENSMUSG00000036613
AA Change: T22I

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
Blast:WD40 57 100 1e-18 BLAST
WD40 122 163 6.39e0 SMART
WD40 172 213 2.29e1 SMART
WD40 216 257 6.38e-7 SMART
WD40 261 301 4.38e-5 SMART
WD40 335 375 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221555
AA Change: T22I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000221877
AA Change: T22I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been reported in PMID 9403053 as one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. Alignment of this gene to genomic sequence data suggests that this gene resides on chromosome 2 rather than chromosome 11. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Eipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Eipr1 APN 12 28864771 missense probably damaging 1.00
hoss UTSW 12 28864762 missense probably damaging 1.00
R0331:Eipr1 UTSW 12 28864704 nonsense probably null
R0352:Eipr1 UTSW 12 28766785 missense probably damaging 0.98
R0433:Eipr1 UTSW 12 28859331 missense possibly damaging 0.68
R1807:Eipr1 UTSW 12 28766839 missense probably damaging 1.00
R1883:Eipr1 UTSW 12 28766851 missense possibly damaging 0.82
R1926:Eipr1 UTSW 12 28864837 splice site probably null
R1981:Eipr1 UTSW 12 28863025 missense probably damaging 1.00
R2433:Eipr1 UTSW 12 28863043 missense probably damaging 1.00
R2970:Eipr1 UTSW 12 28847594 missense probably benign 0.00
R2990:Eipr1 UTSW 12 28859268 missense probably benign 0.06
R4412:Eipr1 UTSW 12 28859373 missense probably damaging 1.00
R4463:Eipr1 UTSW 12 28859339 missense probably damaging 1.00
R5087:Eipr1 UTSW 12 28828856 missense probably benign 0.11
R5430:Eipr1 UTSW 12 28863016 missense probably damaging 1.00
R5619:Eipr1 UTSW 12 28867079 missense probably damaging 1.00
R6454:Eipr1 UTSW 12 28864762 missense probably damaging 1.00
R6696:Eipr1 UTSW 12 28859358 missense probably benign
R7038:Eipr1 UTSW 12 28751818 unclassified probably benign
R7417:Eipr1 UTSW 12 28866955 missense probably benign 0.04
R7808:Eipr1 UTSW 12 28766770 critical splice acceptor site probably null
R8037:Eipr1 UTSW 12 28864677 missense probably benign 0.00
Z1176:Eipr1 UTSW 12 28859287 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TTCACGTACAGATTTGAAGTGC -3'
(R):5'- TGACATACACATGCACCTATGTAC -3'

Sequencing Primer
(F):5'- CGTACAGATTTGAAGTGCAATTGTG -3'
(R):5'- TGCACACGCATAAAGAAGAAACAG -3'
Posted On2015-01-23