Incidental Mutation 'R2877:Adssl1'
ID260634
Institutional Source Beutler Lab
Gene Symbol Adssl1
Ensembl Gene ENSMUSG00000011148
Gene Nameadenylosuccinate synthetase like 1
SynonymsAdss
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112620045-112641360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 112634189 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 197 (K197N)
Ref Sequence ENSEMBL: ENSMUSP00000136572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021726] [ENSMUST00000180015]
Predicted Effect probably damaging
Transcript: ENSMUST00000021726
AA Change: K174N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021726
Gene: ENSMUSG00000011148
AA Change: K174N

DomainStartEndE-ValueType
Adenylsucc_synt 33 455 5.9e-259 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180015
AA Change: K197N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136572
Gene: ENSMUSG00000011148
AA Change: K197N

DomainStartEndE-ValueType
Adenylsucc_synt 33 478 2.17e-248 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223044
Meta Mutation Damage Score 0.8998 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Adssl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Adssl1 APN 12 112634736 splice site probably benign
IGL03105:Adssl1 APN 12 112632721 missense probably benign 0.00
barty UTSW 12 112634189 missense probably damaging 1.00
lannister UTSW 12 112634713 missense probably damaging 1.00
R0179:Adssl1 UTSW 12 112632269 missense probably benign 0.11
R1722:Adssl1 UTSW 12 112636481 missense possibly damaging 0.93
R1911:Adssl1 UTSW 12 112633009 missense probably benign
R4829:Adssl1 UTSW 12 112634713 missense probably damaging 1.00
R5155:Adssl1 UTSW 12 112638208 missense probably damaging 1.00
R6225:Adssl1 UTSW 12 112634403 missense probably damaging 0.96
R6247:Adssl1 UTSW 12 112628356 missense probably damaging 1.00
R6873:Adssl1 UTSW 12 112632704 missense probably benign 0.00
R7012:Adssl1 UTSW 12 112634236 missense probably benign 0.01
R7449:Adssl1 UTSW 12 112634151 missense probably damaging 1.00
R7662:Adssl1 UTSW 12 112639738 missense probably damaging 0.98
R7976:Adssl1 UTSW 12 112636397 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTATGTGCTTGAGCTGTCC -3'
(R):5'- AGGTTCTTGAATCTGTGCAGGC -3'

Sequencing Primer
(F):5'- TGCTTGAGCTGTCCACATG -3'
(R):5'- TTGAATCTGTGCAGGCAACCC -3'
Posted On2015-01-23