Incidental Mutation 'R2877:Rcbtb1'
ID260637
Institutional Source Beutler Lab
Gene Symbol Rcbtb1
Ensembl Gene ENSMUSG00000035469
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location59201209-59237265 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 59210592 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022551] [ENSMUST00000043227] [ENSMUST00000140136] [ENSMUST00000142326] [ENSMUST00000172810] [ENSMUST00000173547] [ENSMUST00000174009]
Predicted Effect probably benign
Transcript: ENSMUST00000022551
SMART Domains Protein: ENSMUSP00000022551
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 40 89 3.9e-8 PFAM
Pfam:RCC1 93 143 2e-13 PFAM
Pfam:RCC1_2 130 159 5.7e-12 PFAM
Pfam:RCC1 146 196 2.2e-13 PFAM
Pfam:RCC1_2 183 212 3.2e-8 PFAM
Pfam:RCC1 199 248 5.3e-17 PFAM
Pfam:RCC1_2 235 264 2.2e-11 PFAM
Pfam:RCC1 251 300 2.3e-15 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043227
SMART Domains Protein: ENSMUSP00000037030
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 40 88 3.2e-7 PFAM
Pfam:RCC1 93 143 2.6e-13 PFAM
Pfam:RCC1_2 130 159 3.7e-12 PFAM
Pfam:RCC1 146 196 3.8e-14 PFAM
Pfam:RCC1_2 183 212 6.5e-8 PFAM
Pfam:RCC1 199 248 1.3e-16 PFAM
Pfam:RCC1_2 235 264 3.5e-10 PFAM
Pfam:RCC1 251 300 1.2e-13 PFAM
BTB 370 467 4.14e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095778
Predicted Effect probably benign
Transcript: ENSMUST00000140136
Predicted Effect probably benign
Transcript: ENSMUST00000142326
Predicted Effect probably benign
Transcript: ENSMUST00000172810
Predicted Effect probably benign
Transcript: ENSMUST00000173547
SMART Domains Protein: ENSMUSP00000134360
Gene: ENSMUSG00000035469

DomainStartEndE-ValueType
Pfam:RCC1 40 89 9.6e-9 PFAM
Pfam:RCC1 93 143 4.7e-14 PFAM
Pfam:RCC1_2 130 159 1.7e-12 PFAM
Pfam:RCC1 146 196 5.3e-14 PFAM
Pfam:RCC1_2 183 208 7.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174009
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal RCC1 domain and a C-terminal BTB (broad complex, tramtrack and bric-a-brac) domain. In rat, over-expression of this gene in vascular smooth muscle cells induced cellular hypertrophy. In rat, the C-terminus of RCBTB1 interacts with the angiotensin II receptor-1A. In humans, this gene maps to a region of chromosome 13q that is frequently deleted in B-cell chronic lymphocytic leukemia and other lymphoid malignancies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Olfr1487 A T 19: 13,619,632 I157F probably damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Rcbtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Rcbtb1 APN 14 59228305 missense probably benign 0.19
IGL01954:Rcbtb1 APN 14 59229967 missense probably damaging 1.00
IGL02458:Rcbtb1 APN 14 59229994 missense probably damaging 1.00
IGL02632:Rcbtb1 APN 14 59224682 missense probably damaging 0.99
IGL02689:Rcbtb1 APN 14 59224700 missense probably damaging 1.00
IGL03201:Rcbtb1 APN 14 59223278 missense probably damaging 1.00
IGL03411:Rcbtb1 APN 14 59209970 start codon destroyed probably null 1.00
R0014:Rcbtb1 UTSW 14 59235242 missense probably benign 0.35
R2858:Rcbtb1 UTSW 14 59221412 splice site probably null
R3890:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R3892:Rcbtb1 UTSW 14 59228355 missense possibly damaging 0.67
R3945:Rcbtb1 UTSW 14 59224776 critical splice donor site probably null
R6869:Rcbtb1 UTSW 14 59217602 missense probably benign 0.01
R7224:Rcbtb1 UTSW 14 59228379 missense probably damaging 1.00
R7910:Rcbtb1 UTSW 14 59236678 missense unknown
R7962:Rcbtb1 UTSW 14 59221567 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ATGCAAGCAGAGGTGTTTGT -3'
(R):5'- TGGCCTCAAATGTCTTAAATTGTTCC -3'

Sequencing Primer
(F):5'- CAAGCAGAGGTGTTTGTTTTCCAG -3'
(R):5'- GGACCCCTGAGATCTTTCAAACATTG -3'
Posted On2015-01-23