Incidental Mutation 'R2877:Muc19'
ID 260639
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Name mucin 19
Synonyms sld, apomucin
MMRRC Submission 040465-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.182) question?
Stock # R2877 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 91722531-91832440 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to A at 91777200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178108
SMART Domains Protein: ENSMUSP00000136475
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
VWD 30 181 1.31e-13 SMART
Pfam:C8 200 277 2.5e-8 PFAM
Pfam:TIL 281 336 7.5e-12 PFAM
Pfam:VWD 377 477 4.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180042
SMART Domains Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
C8 17 91 8.71e-20 SMART
Pfam:TIL 94 151 1.2e-7 PFAM
Pfam:TIL 193 253 6.6e-8 PFAM
VWD 282 445 2.36e-47 SMART
C8 481 555 1.84e-27 SMART
low complexity region 660 701 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,886,811 (GRCm39) probably benign Het
Abca13 C T 11: 9,241,889 (GRCm39) L1251F possibly damaging Het
Accsl A T 2: 93,689,755 (GRCm39) M384K probably damaging Het
Adss1 A C 12: 112,600,623 (GRCm39) K197N probably damaging Het
Alg11 A G 8: 22,555,374 (GRCm39) N170D possibly damaging Het
Ambn T C 5: 88,608,559 (GRCm39) probably benign Het
Anapc7 T C 5: 122,566,219 (GRCm39) Y43H probably benign Het
Anxa10 T A 8: 62,513,373 (GRCm39) I255F probably damaging Het
Atg2b A T 12: 105,630,268 (GRCm39) Y374* probably null Het
Axl T A 7: 25,465,949 (GRCm39) M563L probably damaging Het
Carmil2 A G 8: 106,422,055 (GRCm39) E1108G probably damaging Het
Casp1 T C 9: 5,303,110 (GRCm39) M188T probably damaging Het
Chd3 A T 11: 69,251,998 (GRCm39) C87* probably null Het
Col6a3 G A 1: 90,703,321 (GRCm39) T2475I unknown Het
Creb3l4 A T 3: 90,149,615 (GRCm39) S83R probably damaging Het
Cyp2a4 G A 7: 26,011,612 (GRCm39) E278K possibly damaging Het
Dync1li2 A C 8: 105,156,047 (GRCm39) Y265D probably damaging Het
Eif3f G A 7: 108,534,019 (GRCm39) probably null Het
Eipr1 C T 12: 28,810,091 (GRCm39) T22I possibly damaging Het
Fbxo48 A G 11: 16,903,382 (GRCm39) K3E possibly damaging Het
Fbxw13 A G 9: 109,010,534 (GRCm39) F368S probably damaging Het
Fbxw19 A T 9: 109,315,038 (GRCm39) W175R probably damaging Het
Fibcd1 G A 2: 31,728,678 (GRCm39) P60S probably benign Het
Foxa3 A T 7: 18,748,805 (GRCm39) M107K probably benign Het
Foxj2 G A 6: 122,819,791 (GRCm39) D560N probably damaging Het
Gfm2 A G 13: 97,289,757 (GRCm39) R181G possibly damaging Het
Gpr25 C T 1: 136,188,553 (GRCm39) G20D possibly damaging Het
Grin1 A G 2: 25,187,641 (GRCm39) V594A probably damaging Het
Itpripl1 A G 2: 126,983,534 (GRCm39) V196A probably benign Het
Kcns1 A G 2: 164,006,682 (GRCm39) I427T probably damaging Het
Kiz T C 2: 146,731,476 (GRCm39) V322A possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Naa16 A G 14: 79,580,738 (GRCm39) M592T probably benign Het
Naa80 A T 9: 107,460,367 (GRCm39) E87D possibly damaging Het
Ncapd3 T A 9: 26,955,783 (GRCm39) probably null Het
Nebl C A 2: 17,439,740 (GRCm39) D178Y probably damaging Het
Nedd1 T A 10: 92,549,988 (GRCm39) N99I possibly damaging Het
Nuak1 T C 10: 84,211,209 (GRCm39) D293G possibly damaging Het
Or5b123 A T 19: 13,596,996 (GRCm39) I157F probably damaging Het
Or5m9b T C 2: 85,905,675 (GRCm39) M197T possibly damaging Het
Palb2 A G 7: 121,713,652 (GRCm39) V877A probably damaging Het
Rassf6 C T 5: 90,754,664 (GRCm39) V205I probably damaging Het
Rbak A G 5: 143,159,860 (GRCm39) Y398H probably damaging Het
Rcbtb1 A G 14: 59,448,041 (GRCm39) probably benign Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Smpdl3a C A 10: 57,685,181 (GRCm39) T317K probably damaging Het
Speer4e1 C T 5: 14,987,130 (GRCm39) V92M probably damaging Het
Syne2 A G 12: 76,047,605 (GRCm39) I4009V probably benign Het
Tarbp1 G A 8: 127,154,571 (GRCm39) L1474F probably damaging Het
Tchh A G 3: 93,351,535 (GRCm39) E325G unknown Het
Trpc4 T C 3: 54,198,761 (GRCm39) S562P probably damaging Het
Ttn T C 2: 76,567,409 (GRCm39) D27828G probably damaging Het
Ulk4 T C 9: 121,089,105 (GRCm39) D258G probably benign Het
Vmn1r215 A G 13: 23,260,731 (GRCm39) H257R probably benign Het
Vmn2r56 A C 7: 12,444,954 (GRCm39) M433R probably benign Het
Vmn2r76 C A 7: 85,875,201 (GRCm39) C592F probably benign Het
Zcchc8 C T 5: 123,838,766 (GRCm39) V591I probably benign Het
Znhit6 G C 3: 145,282,409 (GRCm39) G96A probably benign Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91,770,943 (GRCm39) exon noncoding transcript
IGL01017:Muc19 APN 15 91,764,901 (GRCm39) exon noncoding transcript
IGL01140:Muc19 APN 15 91,783,593 (GRCm39) exon noncoding transcript
IGL01292:Muc19 APN 15 91,778,470 (GRCm39) exon noncoding transcript
IGL01397:Muc19 APN 15 91,778,498 (GRCm39) exon noncoding transcript
IGL01525:Muc19 APN 15 91,770,877 (GRCm39) exon noncoding transcript
IGL01589:Muc19 APN 15 91,754,699 (GRCm39) exon noncoding transcript
IGL02023:Muc19 APN 15 91,772,453 (GRCm39) exon noncoding transcript
IGL02088:Muc19 APN 15 91,775,362 (GRCm39) splice site noncoding transcript
IGL02168:Muc19 APN 15 91,778,292 (GRCm39) exon noncoding transcript
IGL02343:Muc19 APN 15 91,778,428 (GRCm39) exon noncoding transcript
IGL02402:Muc19 APN 15 91,778,192 (GRCm39) splice site noncoding transcript
IGL02433:Muc19 APN 15 91,756,694 (GRCm39) exon noncoding transcript
IGL02533:Muc19 APN 15 91,782,241 (GRCm39) exon noncoding transcript
IGL02558:Muc19 APN 15 91,781,816 (GRCm39) exon noncoding transcript
IGL02652:Muc19 APN 15 91,762,009 (GRCm39) critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91,808,424 (GRCm39) unclassified noncoding transcript
IGL02837:Muc19 UTSW 15 91,766,850 (GRCm39) exon noncoding transcript
R0098:Muc19 UTSW 15 91,777,101 (GRCm39) exon noncoding transcript
R0098:Muc19 UTSW 15 91,777,101 (GRCm39) exon noncoding transcript
R0208:Muc19 UTSW 15 91,777,218 (GRCm39) splice site noncoding transcript
R0597:Muc19 UTSW 15 91,784,696 (GRCm39) splice site noncoding transcript
R1185:Muc19 UTSW 15 91,762,743 (GRCm39) exon noncoding transcript
R1185:Muc19 UTSW 15 91,762,743 (GRCm39) exon noncoding transcript
R1469:Muc19 UTSW 15 91,758,498 (GRCm39) unclassified noncoding transcript
R1942:Muc19 UTSW 15 91,776,666 (GRCm39) exon noncoding transcript
R2035:Muc19 UTSW 15 91,776,599 (GRCm39) splice site noncoding transcript
R2208:Muc19 UTSW 15 91,755,747 (GRCm39) exon noncoding transcript
R2897:Muc19 UTSW 15 91,822,550 (GRCm39) critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91,781,816 (GRCm39) exon noncoding transcript
R4403:Muc19 UTSW 15 91,755,768 (GRCm39) exon noncoding transcript
R4606:Muc19 UTSW 15 91,832,268 (GRCm39) exon noncoding transcript
R4677:Muc19 UTSW 15 91,772,411 (GRCm39) exon noncoding transcript
R4753:Muc19 UTSW 15 91,761,955 (GRCm39) unclassified noncoding transcript
R4781:Muc19 UTSW 15 91,787,360 (GRCm39) critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91,781,910 (GRCm39) exon noncoding transcript
R5000:Muc19 UTSW 15 91,757,429 (GRCm39) unclassified noncoding transcript
R5044:Muc19 UTSW 15 91,772,332 (GRCm39) exon noncoding transcript
R5156:Muc19 UTSW 15 91,784,614 (GRCm39) exon noncoding transcript
R5176:Muc19 UTSW 15 91,776,374 (GRCm39) exon noncoding transcript
R5224:Muc19 UTSW 15 91,825,910 (GRCm39) exon noncoding transcript
R5524:Muc19 UTSW 15 91,778,587 (GRCm39) exon noncoding transcript
R5568:Muc19 UTSW 15 91,768,468 (GRCm39) splice site noncoding transcript
R5592:Muc19 UTSW 15 91,828,199 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCCAACCTAAGTTAGCAAAAGG -3'
(R):5'- CTGGAGCCAGCATCACATTG -3'

Sequencing Primer
(F):5'- CCTAAGTTAGCAAAAGGTCTTACG -3'
(R):5'- CCCCTGTACTAATGAGCATAT -3'
Posted On 2015-01-23