Incidental Mutation 'R2893:Kansl1l'
ID260644
Institutional Source Beutler Lab
Gene Symbol Kansl1l
Ensembl Gene ENSMUSG00000026004
Gene NameKAT8 regulatory NSL complex subunit 1-like
Synonyms1110028C15Rik, C430010P07Rik
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66719248-66817562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66801334 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 269 (Q269R)
Ref Sequence ENSEMBL: ENSMUSP00000063843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068168] [ENSMUST00000113987]
Predicted Effect probably damaging
Transcript: ENSMUST00000068168
AA Change: Q269R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063843
Gene: ENSMUSG00000026004
AA Change: Q269R

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
PEHE 755 875 2.42e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113987
AA Change: Q269R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109620
Gene: ENSMUSG00000026004
AA Change: Q269R

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129190
SMART Domains Protein: ENSMUSP00000118603
Gene: ENSMUSG00000026004

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 174 191 N/A INTRINSIC
PEHE 455 575 2.42e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194465
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Kansl1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Kansl1l APN 1 66724574 missense possibly damaging 0.83
IGL00825:Kansl1l APN 1 66801512 missense probably benign
IGL01644:Kansl1l APN 1 66801316 missense probably benign 0.01
IGL01690:Kansl1l APN 1 66801073 missense probably damaging 0.98
IGL01811:Kansl1l APN 1 66723303 missense probably damaging 1.00
IGL01966:Kansl1l APN 1 66738068 missense probably damaging 1.00
IGL02549:Kansl1l APN 1 66801968 missense probably benign 0.44
IGL02578:Kansl1l APN 1 66801689 nonsense probably null
IGL02707:Kansl1l APN 1 66773445 missense probably damaging 1.00
IGL03088:Kansl1l APN 1 66735725 missense probably damaging 0.98
IGL03187:Kansl1l APN 1 66725903 missense probably damaging 1.00
IGL03279:Kansl1l APN 1 66735666 missense probably damaging 0.99
arkansasii UTSW 1 66762103 missense probably damaging 1.00
Kansasii UTSW 1 66778106 missense probably null 0.41
PIT4810001:Kansl1l UTSW 1 66762149 missense probably damaging 1.00
R0068:Kansl1l UTSW 1 66720888 missense probably benign 0.00
R0068:Kansl1l UTSW 1 66720888 missense probably benign 0.00
R0070:Kansl1l UTSW 1 66801103 missense probably damaging 0.99
R0312:Kansl1l UTSW 1 66778106 missense probably null 0.41
R0456:Kansl1l UTSW 1 66735726 missense probably damaging 0.99
R0720:Kansl1l UTSW 1 66801356 missense possibly damaging 0.52
R1381:Kansl1l UTSW 1 66720904 missense probably benign 0.01
R1470:Kansl1l UTSW 1 66801997 missense possibly damaging 0.82
R1470:Kansl1l UTSW 1 66801997 missense possibly damaging 0.82
R1759:Kansl1l UTSW 1 66801888 missense probably damaging 0.96
R1840:Kansl1l UTSW 1 66778032 missense probably damaging 1.00
R2299:Kansl1l UTSW 1 66773477 missense probably damaging 1.00
R2888:Kansl1l UTSW 1 66724605 missense probably benign 0.13
R3735:Kansl1l UTSW 1 66801250 missense possibly damaging 0.90
R4249:Kansl1l UTSW 1 66773478 missense probably damaging 1.00
R4448:Kansl1l UTSW 1 66738159 missense probably damaging 0.99
R4710:Kansl1l UTSW 1 66801496 missense possibly damaging 0.66
R4768:Kansl1l UTSW 1 66801133 missense probably damaging 1.00
R5523:Kansl1l UTSW 1 66802112 missense probably benign 0.00
R5645:Kansl1l UTSW 1 66801344 missense probably benign 0.27
R5840:Kansl1l UTSW 1 66770215 intron probably benign
R5964:Kansl1l UTSW 1 66725922 missense probably damaging 1.00
R5990:Kansl1l UTSW 1 66735726 missense probably damaging 0.98
R6009:Kansl1l UTSW 1 66735600 missense probably benign 0.00
R6051:Kansl1l UTSW 1 66726726 missense probably null 1.00
R6092:Kansl1l UTSW 1 66773484 missense probably damaging 1.00
R6316:Kansl1l UTSW 1 66735585 missense probably benign
R6402:Kansl1l UTSW 1 66762193 missense probably damaging 0.99
R6906:Kansl1l UTSW 1 66723278 missense possibly damaging 0.76
R7241:Kansl1l UTSW 1 66801628 missense possibly damaging 0.91
R7434:Kansl1l UTSW 1 66762103 missense probably damaging 1.00
R7716:Kansl1l UTSW 1 66801133 missense probably damaging 1.00
R7793:Kansl1l UTSW 1 66778014 missense probably damaging 1.00
R8187:Kansl1l UTSW 1 66801737 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATGAGACAACAGCCCTGTAGC -3'
(R):5'- ACCTAGCCACTCAGATGTGC -3'

Sequencing Primer
(F):5'- CAGACAGTGCAAATCTTTGGATTTC -3'
(R):5'- TAGCCACTCAGATGTGCCTACTAG -3'
Posted On2015-01-23