Mutagenetix > Incidental Mutations

Incidental Mutation 'R2893:Kansl1l'

260644

Institutional Source

Beutler Lab

Gene Symbol

Kansl1l

Ensembl Gene

ENSMUSG00000026004

Gene Name

KAT8 regulatory NSL complex subunit 1-like

Synonyms

1110028C15Rik, C430010P07Rik

MMRRC Submission

040481-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R2893 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66719248-66817562 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66801334 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 269 (Q269R)

Ref Sequence

ENSEMBL: ENSMUSP00000063843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068168] [ENSMUST00000113987]

Predicted Effect

probably damaging
Transcript: ENSMUST00000068168
AA Change: Q269R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063843
Gene: ENSMUSG00000026004
AA Change: Q269R

Domain	Start	End	E-Value	Type
low complexity region	340	355	N/A	INTRINSIC
low complexity region	491	507	N/A	INTRINSIC
low complexity region	518	535	N/A	INTRINSIC
PEHE	755	875	2.42e-33	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113987
AA Change: Q269R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109620
Gene: ENSMUSG00000026004
AA Change: Q269R

Domain	Start	End	E-Value	Type
low complexity region	340	355	N/A	INTRINSIC
low complexity region	491	507	N/A	INTRINSIC
low complexity region	518	535	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129190

SMART Domains

Protein: ENSMUSP00000118603
Gene: ENSMUSG00000026004

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	147	163	N/A	INTRINSIC
low complexity region	174	191	N/A	INTRINSIC
PEHE	455	575	2.42e-33	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132960

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189846

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194465

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Abl1	T	G	2: 31,797,612	S521R	probably benign	Het
Acox3	A	G	5: 35,599,848	I344V	probably benign	Het
Ank2	T	C	3: 127,248,243		probably null	Het
Atoh8	A	T	6: 72,234,872	F98Y	probably benign	Het
Caskin2	C	T	11: 115,801,277	G894E	probably benign	Het
Cdh15	G	A	8: 122,856,635	R59H	probably benign	Het
Cdk5rap2	T	C	4: 70,289,873	K779E	probably benign	Het
Csmd2	T	A	4: 128,538,993		probably null	Het
Cubn	T	C	2: 13,358,139	D1687G	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Faap100	T	C	11: 120,374,625	D475G	probably damaging	Het
Fam160b1	C	T	19: 57,384,169	P617L	probably benign	Het
Gm13090	T	A	4: 151,090,700	L78*	probably null	Het
Gm8394	T	C	10: 85,313,984		noncoding transcript	Het
Ikbke	G	A	1: 131,270,224	P382S	probably damaging	Het
Il4i1	A	G	7: 44,837,990	I130V	probably damaging	Het
Islr2	A	T	9: 58,197,866	S704T	probably damaging	Het
Itga10	A	G	3: 96,655,100	N733D	probably benign	Het
Itih2	C	T	2: 10,102,197	G662D	possibly damaging	Het
Kcnj3	A	T	2: 55,447,015	I298F	probably damaging	Het
Kdr	A	G	5: 75,946,836	F1016L	probably damaging	Het
Miga2	A	T	2: 30,378,294		probably null	Het
Olfr632	A	T	7: 103,938,182	R267S	probably damaging	Het
Per2	C	A	1: 91,445,603	Q154H	probably damaging	Het
Pik3ap1	G	A	19: 41,376,061	A73V	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Rad18	G	A	6: 112,675,773	Q288*	probably null	Het
Rapsn	A	T	2: 91,036,824	D157V	probably damaging	Het
Slc2a8	A	T	2: 32,974,954	W394R	probably damaging	Het
Srcap	T	C	7: 127,539,065	S1136P	probably damaging	Het
Tenm4	T	A	7: 96,894,990	V2108D	probably damaging	Het
Trappc10	C	T	10: 78,193,401	V1101M	probably benign	Het
Ttbk2	C	A	2: 120,745,610		probably null	Het
Usp8	A	T	2: 126,758,155	Q998L	probably damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r80	T	C	10: 79,148,865	F17S	possibly damaging	Het

Other mutations in Kansl1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00576:Kansl1l	APN	1	66724574	missense	possibly damaging	0.83
IGL00825:Kansl1l	APN	1	66801512	missense	probably benign
IGL01644:Kansl1l	APN	1	66801316	missense	probably benign	0.01
IGL01690:Kansl1l	APN	1	66801073	missense	probably damaging	0.98
IGL01811:Kansl1l	APN	1	66723303	missense	probably damaging	1.00
IGL01966:Kansl1l	APN	1	66738068	missense	probably damaging	1.00
IGL02549:Kansl1l	APN	1	66801968	missense	probably benign	0.44
IGL02578:Kansl1l	APN	1	66801689	nonsense	probably null
IGL02707:Kansl1l	APN	1	66773445	missense	probably damaging	1.00
IGL03088:Kansl1l	APN	1	66735725	missense	probably damaging	0.98
IGL03187:Kansl1l	APN	1	66725903	missense	probably damaging	1.00
IGL03279:Kansl1l	APN	1	66735666	missense	probably damaging	0.99
arkansasii	UTSW	1	66762103	missense	probably damaging	1.00
Kansasii	UTSW	1	66778106	missense	probably null	0.41
PIT4810001:Kansl1l	UTSW	1	66762149	missense	probably damaging	1.00
R0068:Kansl1l	UTSW	1	66720888	missense	probably benign	0.00
R0068:Kansl1l	UTSW	1	66720888	missense	probably benign	0.00
R0070:Kansl1l	UTSW	1	66801103	missense	probably damaging	0.99
R0312:Kansl1l	UTSW	1	66778106	missense	probably null	0.41
R0456:Kansl1l	UTSW	1	66735726	missense	probably damaging	0.99
R0720:Kansl1l	UTSW	1	66801356	missense	possibly damaging	0.52
R1381:Kansl1l	UTSW	1	66720904	missense	probably benign	0.01
R1470:Kansl1l	UTSW	1	66801997	missense	possibly damaging	0.82
R1470:Kansl1l	UTSW	1	66801997	missense	possibly damaging	0.82
R1759:Kansl1l	UTSW	1	66801888	missense	probably damaging	0.96
R1840:Kansl1l	UTSW	1	66778032	missense	probably damaging	1.00
R2299:Kansl1l	UTSW	1	66773477	missense	probably damaging	1.00
R2888:Kansl1l	UTSW	1	66724605	missense	probably benign	0.13
R3735:Kansl1l	UTSW	1	66801250	missense	possibly damaging	0.90
R4249:Kansl1l	UTSW	1	66773478	missense	probably damaging	1.00
R4448:Kansl1l	UTSW	1	66738159	missense	probably damaging	0.99
R4710:Kansl1l	UTSW	1	66801496	missense	possibly damaging	0.66
R4768:Kansl1l	UTSW	1	66801133	missense	probably damaging	1.00
R5523:Kansl1l	UTSW	1	66802112	missense	probably benign	0.00
R5645:Kansl1l	UTSW	1	66801344	missense	probably benign	0.27
R5840:Kansl1l	UTSW	1	66770215	intron	probably benign
R5964:Kansl1l	UTSW	1	66725922	missense	probably damaging	1.00
R5990:Kansl1l	UTSW	1	66735726	missense	probably damaging	0.98
R6009:Kansl1l	UTSW	1	66735600	missense	probably benign	0.00
R6051:Kansl1l	UTSW	1	66726726	missense	probably null	1.00
R6092:Kansl1l	UTSW	1	66773484	missense	probably damaging	1.00
R6316:Kansl1l	UTSW	1	66735585	missense	probably benign
R6402:Kansl1l	UTSW	1	66762193	missense	probably damaging	0.99
R6906:Kansl1l	UTSW	1	66723278	missense	possibly damaging	0.76
R7241:Kansl1l	UTSW	1	66801628	missense	possibly damaging	0.91
R7434:Kansl1l	UTSW	1	66762103	missense	probably damaging	1.00
R7716:Kansl1l	UTSW	1	66801133	missense	probably damaging	1.00
R7793:Kansl1l	UTSW	1	66778014	missense	probably damaging	1.00
R8187:Kansl1l	UTSW	1	66801737	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- ATGAGACAACAGCCCTGTAGC -3'
(R):5'- ACCTAGCCACTCAGATGTGC -3'

Sequencing Primer
(F):5'- CAGACAGTGCAAATCTTTGGATTTC -3'
(R):5'- TAGCCACTCAGATGTGCCTACTAG -3'

Posted On

2015-01-23