Incidental Mutation 'R2893:Kansl1l'
ID 260644
Institutional Source Beutler Lab
Gene Symbol Kansl1l
Ensembl Gene ENSMUSG00000026004
Gene Name KAT8 regulatory NSL complex subunit 1-like
Synonyms 1110028C15Rik, C430010P07Rik
MMRRC Submission 040481-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R2893 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 66758407-66856721 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66840493 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 269 (Q269R)
Ref Sequence ENSEMBL: ENSMUSP00000063843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068168] [ENSMUST00000113987]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068168
AA Change: Q269R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063843
Gene: ENSMUSG00000026004
AA Change: Q269R

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
PEHE 755 875 2.42e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113987
AA Change: Q269R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109620
Gene: ENSMUSG00000026004
AA Change: Q269R

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129190
SMART Domains Protein: ENSMUSP00000118603
Gene: ENSMUSG00000026004

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 174 191 N/A INTRINSIC
PEHE 455 575 2.42e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194465
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Abl1 T G 2: 31,687,624 (GRCm39) S521R probably benign Het
Acox3 A G 5: 35,757,192 (GRCm39) I344V probably benign Het
Ank2 T C 3: 127,041,892 (GRCm39) probably null Het
Atoh8 A T 6: 72,211,856 (GRCm39) F98Y probably benign Het
Caskin2 C T 11: 115,692,103 (GRCm39) G894E probably benign Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Cdk5rap2 T C 4: 70,208,110 (GRCm39) K779E probably benign Het
Csmd2 T A 4: 128,432,786 (GRCm39) probably null Het
Cubn T C 2: 13,362,950 (GRCm39) D1687G possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Faap100 T C 11: 120,265,451 (GRCm39) D475G probably damaging Het
Fhip2a C T 19: 57,372,601 (GRCm39) P617L probably benign Het
Gm13090 T A 4: 151,175,157 (GRCm39) L78* probably null Het
Ikbke G A 1: 131,197,961 (GRCm39) P382S probably damaging Het
Il4i1 A G 7: 44,487,414 (GRCm39) I130V probably damaging Het
Islr2 A T 9: 58,105,149 (GRCm39) S704T probably damaging Het
Itga10 A G 3: 96,562,416 (GRCm39) N733D probably benign Het
Itih2 C T 2: 10,107,008 (GRCm39) G662D possibly damaging Het
Kcnj3 A T 2: 55,337,027 (GRCm39) I298F probably damaging Het
Kdr A G 5: 76,107,496 (GRCm39) F1016L probably damaging Het
Miga2 A T 2: 30,268,306 (GRCm39) probably null Het
Or51ai2 A T 7: 103,587,389 (GRCm39) R267S probably damaging Het
Per2 C A 1: 91,373,325 (GRCm39) Q154H probably damaging Het
Pik3ap1 G A 19: 41,364,500 (GRCm39) A73V probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Psma5-ps T C 10: 85,149,848 (GRCm39) noncoding transcript Het
Rad18 G A 6: 112,652,734 (GRCm39) Q288* probably null Het
Rapsn A T 2: 90,867,169 (GRCm39) D157V probably damaging Het
Slc2a8 A T 2: 32,864,966 (GRCm39) W394R probably damaging Het
Srcap T C 7: 127,138,237 (GRCm39) S1136P probably damaging Het
Tenm4 T A 7: 96,544,197 (GRCm39) V2108D probably damaging Het
Trappc10 C T 10: 78,029,235 (GRCm39) V1101M probably benign Het
Ttbk2 C A 2: 120,576,091 (GRCm39) probably null Het
Usp8 A T 2: 126,600,075 (GRCm39) Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r80 T C 10: 78,984,699 (GRCm39) F17S possibly damaging Het
Other mutations in Kansl1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Kansl1l APN 1 66,763,733 (GRCm39) missense possibly damaging 0.83
IGL00825:Kansl1l APN 1 66,840,671 (GRCm39) missense probably benign
IGL01644:Kansl1l APN 1 66,840,475 (GRCm39) missense probably benign 0.01
IGL01690:Kansl1l APN 1 66,840,232 (GRCm39) missense probably damaging 0.98
IGL01811:Kansl1l APN 1 66,762,462 (GRCm39) missense probably damaging 1.00
IGL01966:Kansl1l APN 1 66,777,227 (GRCm39) missense probably damaging 1.00
IGL02549:Kansl1l APN 1 66,841,127 (GRCm39) missense probably benign 0.44
IGL02578:Kansl1l APN 1 66,840,848 (GRCm39) nonsense probably null
IGL02707:Kansl1l APN 1 66,812,604 (GRCm39) missense probably damaging 1.00
IGL03088:Kansl1l APN 1 66,774,884 (GRCm39) missense probably damaging 0.98
IGL03187:Kansl1l APN 1 66,765,062 (GRCm39) missense probably damaging 1.00
IGL03279:Kansl1l APN 1 66,774,825 (GRCm39) missense probably damaging 0.99
arkansasii UTSW 1 66,801,262 (GRCm39) missense probably damaging 1.00
Kansasii UTSW 1 66,817,265 (GRCm39) missense probably null 0.41
PIT4810001:Kansl1l UTSW 1 66,801,308 (GRCm39) missense probably damaging 1.00
R0068:Kansl1l UTSW 1 66,760,047 (GRCm39) missense probably benign 0.00
R0068:Kansl1l UTSW 1 66,760,047 (GRCm39) missense probably benign 0.00
R0070:Kansl1l UTSW 1 66,840,262 (GRCm39) missense probably damaging 0.99
R0312:Kansl1l UTSW 1 66,817,265 (GRCm39) missense probably null 0.41
R0456:Kansl1l UTSW 1 66,774,885 (GRCm39) missense probably damaging 0.99
R0720:Kansl1l UTSW 1 66,840,515 (GRCm39) missense possibly damaging 0.52
R1381:Kansl1l UTSW 1 66,760,063 (GRCm39) missense probably benign 0.01
R1470:Kansl1l UTSW 1 66,841,156 (GRCm39) missense possibly damaging 0.82
R1470:Kansl1l UTSW 1 66,841,156 (GRCm39) missense possibly damaging 0.82
R1759:Kansl1l UTSW 1 66,841,047 (GRCm39) missense probably damaging 0.96
R1840:Kansl1l UTSW 1 66,817,191 (GRCm39) missense probably damaging 1.00
R2299:Kansl1l UTSW 1 66,812,636 (GRCm39) missense probably damaging 1.00
R2888:Kansl1l UTSW 1 66,763,764 (GRCm39) missense probably benign 0.13
R3735:Kansl1l UTSW 1 66,840,409 (GRCm39) missense possibly damaging 0.90
R4249:Kansl1l UTSW 1 66,812,637 (GRCm39) missense probably damaging 1.00
R4448:Kansl1l UTSW 1 66,777,318 (GRCm39) missense probably damaging 0.99
R4710:Kansl1l UTSW 1 66,840,655 (GRCm39) missense possibly damaging 0.66
R4768:Kansl1l UTSW 1 66,840,292 (GRCm39) missense probably damaging 1.00
R5523:Kansl1l UTSW 1 66,841,271 (GRCm39) missense probably benign 0.00
R5645:Kansl1l UTSW 1 66,840,503 (GRCm39) missense probably benign 0.27
R5840:Kansl1l UTSW 1 66,809,374 (GRCm39) intron probably benign
R5964:Kansl1l UTSW 1 66,765,081 (GRCm39) missense probably damaging 1.00
R5990:Kansl1l UTSW 1 66,774,885 (GRCm39) missense probably damaging 0.98
R6009:Kansl1l UTSW 1 66,774,759 (GRCm39) missense probably benign 0.00
R6051:Kansl1l UTSW 1 66,765,885 (GRCm39) missense probably null 1.00
R6092:Kansl1l UTSW 1 66,812,643 (GRCm39) missense probably damaging 1.00
R6316:Kansl1l UTSW 1 66,774,744 (GRCm39) missense probably benign
R6402:Kansl1l UTSW 1 66,801,352 (GRCm39) missense probably damaging 0.99
R6906:Kansl1l UTSW 1 66,762,437 (GRCm39) missense possibly damaging 0.76
R7241:Kansl1l UTSW 1 66,840,787 (GRCm39) missense possibly damaging 0.91
R7434:Kansl1l UTSW 1 66,801,262 (GRCm39) missense probably damaging 1.00
R7716:Kansl1l UTSW 1 66,840,292 (GRCm39) missense probably damaging 1.00
R7793:Kansl1l UTSW 1 66,817,173 (GRCm39) missense probably damaging 1.00
R8187:Kansl1l UTSW 1 66,840,896 (GRCm39) missense possibly damaging 0.77
R8972:Kansl1l UTSW 1 66,812,101 (GRCm39) missense probably damaging 1.00
R9347:Kansl1l UTSW 1 66,840,347 (GRCm39) missense probably benign 0.14
R9386:Kansl1l UTSW 1 66,765,129 (GRCm39) missense probably damaging 1.00
R9749:Kansl1l UTSW 1 66,760,970 (GRCm39) missense probably damaging 1.00
R9750:Kansl1l UTSW 1 66,817,150 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATGAGACAACAGCCCTGTAGC -3'
(R):5'- ACCTAGCCACTCAGATGTGC -3'

Sequencing Primer
(F):5'- CAGACAGTGCAAATCTTTGGATTTC -3'
(R):5'- TAGCCACTCAGATGTGCCTACTAG -3'
Posted On 2015-01-23