Incidental Mutation 'R2893:Per2'
ID260645
Institutional Source Beutler Lab
Gene Symbol Per2
Ensembl Gene ENSMUSG00000055866
Gene Nameperiod circadian clock 2
SynonymsmPer2
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location91415982-91459324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91445603 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 154 (Q154H)
Ref Sequence ENSEMBL: ENSMUSP00000066620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069620]
Predicted Effect probably damaging
Transcript: ENSMUST00000069620
AA Change: Q154H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: Q154H

DomainStartEndE-ValueType
PAS 179 246 3.23e1 SMART
PAS 319 385 5.75e-2 SMART
PAC 393 436 1.6e0 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 821 834 N/A INTRINSIC
low complexity region 996 1014 N/A INTRINSIC
Pfam:Period_C 1040 1234 2.7e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185298
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Per2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Per2 APN 1 91448833 missense probably damaging 0.98
IGL01350:Per2 APN 1 91430861 missense probably damaging 1.00
IGL01865:Per2 APN 1 91421517 missense probably benign 0.10
IGL01974:Per2 APN 1 91423718 missense probably benign 0.02
IGL02118:Per2 APN 1 91424309 missense probably damaging 0.99
IGL02271:Per2 APN 1 91445610 missense probably damaging 1.00
IGL02533:Per2 APN 1 91431002 missense possibly damaging 0.92
IGL02707:Per2 APN 1 91450728 missense possibly damaging 0.94
IGL02972:Per2 APN 1 91423981 missense possibly damaging 0.50
IGL03118:Per2 APN 1 91444619 nonsense probably null
IGL03125:Per2 APN 1 91450611 missense probably benign 0.00
IGL03375:Per2 APN 1 91424228 missense possibly damaging 0.76
IGL03388:Per2 APN 1 91444789 splice site probably benign
Kortiku UTSW 1 91423829 missense probably damaging 1.00
obst UTSW 1 91445539 missense probably benign 0.00
rhythm UTSW 1 91429382 critical splice donor site probably null
ANU23:Per2 UTSW 1 91448833 missense probably damaging 0.98
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0542:Per2 UTSW 1 91438332 critical splice donor site probably null
R0764:Per2 UTSW 1 91429420 missense probably damaging 1.00
R1370:Per2 UTSW 1 91445557 missense possibly damaging 0.94
R1655:Per2 UTSW 1 91448768 missense probably damaging 1.00
R1688:Per2 UTSW 1 91423829 missense probably damaging 1.00
R1997:Per2 UTSW 1 91440859 missense probably damaging 1.00
R2891:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2894:Per2 UTSW 1 91445603 missense probably damaging 1.00
R3109:Per2 UTSW 1 91445575 missense probably benign 0.02
R4125:Per2 UTSW 1 91429450 missense possibly damaging 0.71
R4997:Per2 UTSW 1 91450783 missense probably benign 0.02
R5110:Per2 UTSW 1 91429515 missense possibly damaging 0.57
R5478:Per2 UTSW 1 91432868 missense probably benign 0.09
R5590:Per2 UTSW 1 91427856 nonsense probably null
R5634:Per2 UTSW 1 91444707 missense probably benign 0.02
R5654:Per2 UTSW 1 91445501 splice site probably null
R5928:Per2 UTSW 1 91444651 missense probably damaging 1.00
R6241:Per2 UTSW 1 91421529 missense probably damaging 0.97
R6295:Per2 UTSW 1 91449872 missense unknown
R6345:Per2 UTSW 1 91448722 missense probably damaging 1.00
R6480:Per2 UTSW 1 91429382 critical splice donor site probably null
R6502:Per2 UTSW 1 91427763 missense probably benign 0.01
R6702:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6703:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6790:Per2 UTSW 1 91445539 missense probably benign 0.00
R7043:Per2 UTSW 1 91419408 missense probably benign
R7092:Per2 UTSW 1 91421431 missense probably damaging 1.00
R7430:Per2 UTSW 1 91423983 nonsense probably null
R7555:Per2 UTSW 1 91435135 missense probably damaging 1.00
R7860:Per2 UTSW 1 91444759 missense probably damaging 0.99
R7943:Per2 UTSW 1 91444759 missense probably damaging 0.99
R8046:Per2 UTSW 1 91435703 missense possibly damaging 0.56
X0011:Per2 UTSW 1 91420589 missense possibly damaging 0.85
Z1176:Per2 UTSW 1 91421493 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGAGATGAAGACTTCACTCGAG -3'
(R):5'- CTAACAAAGGCCTGGTGTGC -3'

Sequencing Primer
(F):5'- CGTGATTTTATTCAGAGATCCGC -3'
(R):5'- TGTGCCAGAGAAACTGTGCTC -3'
Posted On2015-01-23