Incidental Mutation 'R2893:Ikbke'
ID260646
Institutional Source Beutler Lab
Gene Symbol Ikbke
Ensembl Gene ENSMUSG00000042349
Gene Nameinhibitor of kappaB kinase epsilon
SynonymsIKK-i, IKKepsilon
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location131254343-131279606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131270224 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 382 (P382S)
Ref Sequence ENSEMBL: ENSMUSP00000124190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062108] [ENSMUST00000159195] [ENSMUST00000161764]
Predicted Effect probably damaging
Transcript: ENSMUST00000062108
AA Change: P406S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054126
Gene: ENSMUSG00000042349
AA Change: P406S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 249 1.1e-29 PFAM
Pfam:Pkinase 9 301 6.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159195
SMART Domains Protein: ENSMUSP00000124486
Gene: ENSMUSG00000042349

DomainStartEndE-ValueType
Pfam:Pkinase 9 130 2.2e-23 PFAM
Pfam:Pkinase_Tyr 9 130 2.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160748
Predicted Effect probably damaging
Transcript: ENSMUST00000161764
AA Change: P382S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124190
Gene: ENSMUSG00000042349
AA Change: P382S

DomainStartEndE-ValueType
Pfam:Pkinase 49 278 9.3e-31 PFAM
Pfam:Pkinase_Tyr 50 226 5.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186240
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IKBKE is a noncanonical I-kappa-B (see MIM 164008) kinase (IKK) that is essential for regulating antiviral signaling pathways. IKBKE has also been identified as a breast cancer (MIM 114480) oncogene and is amplified and overexpressed in over 30% of breast carcinomas and breast cancer cell lines (Hutti et al., 2009 [PubMed 19481526]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Ikbke
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ikbke APN 1 131270012 splice site probably null
IGL00703:Ikbke APN 1 131255302 utr 3 prime probably benign
IGL01079:Ikbke APN 1 131265647 missense possibly damaging 0.64
IGL01106:Ikbke APN 1 131260055 splice site probably benign
IGL01336:Ikbke APN 1 131273756 missense probably damaging 1.00
IGL01505:Ikbke APN 1 131255311 missense probably benign 0.00
IGL01564:Ikbke APN 1 131257921 missense probably benign 0.37
IGL01568:Ikbke APN 1 131257896 splice site probably null
IGL01668:Ikbke APN 1 131256938 missense probably benign 0.05
IGL01977:Ikbke APN 1 131272101 splice site probably benign
IGL02162:Ikbke APN 1 131273715 missense possibly damaging 0.69
IGL02653:Ikbke APN 1 131271835 missense possibly damaging 0.89
IGL02859:Ikbke APN 1 131270197 missense probably damaging 0.97
triathelon UTSW 1 131275267 frame shift probably null
R0028:Ikbke UTSW 1 131272184 missense possibly damaging 0.87
R0427:Ikbke UTSW 1 131257910 missense possibly damaging 0.62
R0607:Ikbke UTSW 1 131270184 critical splice donor site probably null
R1295:Ikbke UTSW 1 131270226 missense probably benign 0.03
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1470:Ikbke UTSW 1 131276487 missense probably null 1.00
R1720:Ikbke UTSW 1 131259210 missense possibly damaging 0.94
R1728:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1728:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1729:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1729:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1730:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1730:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1739:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1739:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1748:Ikbke UTSW 1 131259200 missense probably benign 0.02
R1762:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1762:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1763:Ikbke UTSW 1 131265877 missense probably benign 0.01
R1783:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1783:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1784:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1784:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1785:Ikbke UTSW 1 131265937 missense probably benign 0.01
R1785:Ikbke UTSW 1 131269823 missense probably benign 0.00
R1794:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R2143:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2144:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2145:Ikbke UTSW 1 131273474 missense probably damaging 0.98
R2386:Ikbke UTSW 1 131259266 missense probably damaging 1.00
R4210:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4211:Ikbke UTSW 1 131263348 missense probably damaging 0.97
R4284:Ikbke UTSW 1 131275778 critical splice donor site probably null
R4461:Ikbke UTSW 1 131265922 missense probably benign
R4551:Ikbke UTSW 1 131258033 intron probably benign
R4560:Ikbke UTSW 1 131272120 missense probably damaging 1.00
R4849:Ikbke UTSW 1 131275267 frame shift probably null
R4855:Ikbke UTSW 1 131257111 splice site probably null
R4876:Ikbke UTSW 1 131275267 frame shift probably null
R4879:Ikbke UTSW 1 131275267 frame shift probably null
R4967:Ikbke UTSW 1 131275267 frame shift probably null
R4968:Ikbke UTSW 1 131275267 frame shift probably null
R4971:Ikbke UTSW 1 131275267 frame shift probably null
R5020:Ikbke UTSW 1 131273660 missense probably damaging 1.00
R5699:Ikbke UTSW 1 131276467 critical splice donor site probably null
R5814:Ikbke UTSW 1 131271779 missense probably damaging 0.96
R6392:Ikbke UTSW 1 131275146 splice site probably null
R6492:Ikbke UTSW 1 131259218 missense probably damaging 1.00
R6899:Ikbke UTSW 1 131275762 missense probably damaging 1.00
R7552:Ikbke UTSW 1 131272150 nonsense probably null
R7583:Ikbke UTSW 1 131276479 missense probably damaging 0.99
R7652:Ikbke UTSW 1 131271832 missense probably damaging 1.00
R7806:Ikbke UTSW 1 131271898 missense probably damaging 1.00
R7984:Ikbke UTSW 1 131275786 missense probably null 1.00
R8211:Ikbke UTSW 1 131271778 missense probably damaging 0.96
R8309:Ikbke UTSW 1 131263328 nonsense probably null
X0026:Ikbke UTSW 1 131257986 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTTTGCTATGCACTCCTC -3'
(R):5'- AACTTTGAGGATCCACAGGG -3'

Sequencing Primer
(F):5'- GCTTCACGGTACTCACAGGAC -3'
(R):5'- TTTGAGGATCCACAGGGTCGAC -3'
Posted On2015-01-23