Incidental Mutation 'R2893:Abl1'
ID 260650
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Name c-abl oncogene 1, non-receptor tyrosine kinase
Synonyms c-Abl, E430008G22Rik
MMRRC Submission 040481-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.950) question?
Stock # R2893 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 31578388-31694239 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 31687624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 521 (S521R)
Ref Sequence ENSEMBL: ENSMUSP00000028190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000075759] [ENSMUST00000142554]
AlphaFold P00520
PDB Structure CRYSTAL STRUCTURE OF THE COMPLEX OF THE ABL TYROSINE KINASE SH3 DOMAIN WITH 3BP-1 SYNTHETIC PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE UNLIGANDED ABL TYROSINE KINASE SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF ABL KINASE DOMAIN IN COMPLEX WITH A SMALL MOLECULE INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE C-ABL KINASE DOMAIN IN COMPLEX WITH STI-571. [X-RAY DIFFRACTION]
Crystal Structure of the c-Abl Kinase domain in complex with PD173955 [X-RAY DIFFRACTION]
Structural basis for the auto-inhibition of c-Abl tyrosine kinase [X-RAY DIFFRACTION]
Structural basis for the auto-inhibition of c-Abl tyrosine kinase [X-RAY DIFFRACTION]
Abl kinase domain in complex with NVP-AFG210 [X-RAY DIFFRACTION]
Crystal Structure of Abl kinase bound with PPY-A [X-RAY DIFFRACTION]
Crystal Structure of the T315I Mutant of Abl kinase bound with PPY-A [X-RAY DIFFRACTION]
>> 11 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000028190
AA Change: S521R

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: S521R

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075759
AA Change: S540R

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: S540R

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127714
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Acox3 A G 5: 35,757,192 (GRCm39) I344V probably benign Het
Ank2 T C 3: 127,041,892 (GRCm39) probably null Het
Atoh8 A T 6: 72,211,856 (GRCm39) F98Y probably benign Het
Caskin2 C T 11: 115,692,103 (GRCm39) G894E probably benign Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Cdk5rap2 T C 4: 70,208,110 (GRCm39) K779E probably benign Het
Csmd2 T A 4: 128,432,786 (GRCm39) probably null Het
Cubn T C 2: 13,362,950 (GRCm39) D1687G possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Faap100 T C 11: 120,265,451 (GRCm39) D475G probably damaging Het
Fhip2a C T 19: 57,372,601 (GRCm39) P617L probably benign Het
Gm13090 T A 4: 151,175,157 (GRCm39) L78* probably null Het
Ikbke G A 1: 131,197,961 (GRCm39) P382S probably damaging Het
Il4i1 A G 7: 44,487,414 (GRCm39) I130V probably damaging Het
Islr2 A T 9: 58,105,149 (GRCm39) S704T probably damaging Het
Itga10 A G 3: 96,562,416 (GRCm39) N733D probably benign Het
Itih2 C T 2: 10,107,008 (GRCm39) G662D possibly damaging Het
Kansl1l T C 1: 66,840,493 (GRCm39) Q269R probably damaging Het
Kcnj3 A T 2: 55,337,027 (GRCm39) I298F probably damaging Het
Kdr A G 5: 76,107,496 (GRCm39) F1016L probably damaging Het
Miga2 A T 2: 30,268,306 (GRCm39) probably null Het
Or51ai2 A T 7: 103,587,389 (GRCm39) R267S probably damaging Het
Per2 C A 1: 91,373,325 (GRCm39) Q154H probably damaging Het
Pik3ap1 G A 19: 41,364,500 (GRCm39) A73V probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Psma5-ps T C 10: 85,149,848 (GRCm39) noncoding transcript Het
Rad18 G A 6: 112,652,734 (GRCm39) Q288* probably null Het
Rapsn A T 2: 90,867,169 (GRCm39) D157V probably damaging Het
Slc2a8 A T 2: 32,864,966 (GRCm39) W394R probably damaging Het
Srcap T C 7: 127,138,237 (GRCm39) S1136P probably damaging Het
Tenm4 T A 7: 96,544,197 (GRCm39) V2108D probably damaging Het
Trappc10 C T 10: 78,029,235 (GRCm39) V1101M probably benign Het
Ttbk2 C A 2: 120,576,091 (GRCm39) probably null Het
Usp8 A T 2: 126,600,075 (GRCm39) Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r80 T C 10: 78,984,699 (GRCm39) F17S possibly damaging Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31,680,824 (GRCm39) missense probably damaging 1.00
IGL01453:Abl1 APN 2 31,668,989 (GRCm39) missense probably damaging 0.99
IGL02079:Abl1 APN 2 31,579,960 (GRCm39) splice site probably benign
IGL02179:Abl1 APN 2 31,682,261 (GRCm39) missense probably damaging 1.00
IGL02424:Abl1 APN 2 31,691,144 (GRCm39) missense probably benign
IGL02824:Abl1 APN 2 31,690,831 (GRCm39) missense probably damaging 1.00
Hourglass UTSW 2 31,684,586 (GRCm39) missense probably damaging 1.00
Sands UTSW 2 31,669,022 (GRCm39) missense probably damaging 1.00
R0733:Abl1 UTSW 2 31,668,957 (GRCm39) missense probably damaging 1.00
R1222:Abl1 UTSW 2 31,691,006 (GRCm39) missense probably benign
R1428:Abl1 UTSW 2 31,691,822 (GRCm39) missense probably damaging 0.99
R1582:Abl1 UTSW 2 31,690,371 (GRCm39) missense probably damaging 1.00
R1596:Abl1 UTSW 2 31,680,350 (GRCm39) missense probably damaging 0.99
R1824:Abl1 UTSW 2 31,690,656 (GRCm39) missense probably benign 0.01
R2240:Abl1 UTSW 2 31,690,517 (GRCm39) missense probably benign 0.17
R2251:Abl1 UTSW 2 31,669,131 (GRCm39) missense probably damaging 1.00
R2405:Abl1 UTSW 2 31,690,986 (GRCm39) missense possibly damaging 0.50
R3952:Abl1 UTSW 2 31,674,549 (GRCm39) missense probably damaging 1.00
R4119:Abl1 UTSW 2 31,691,739 (GRCm39) missense probably damaging 1.00
R4210:Abl1 UTSW 2 31,691,708 (GRCm39) missense probably damaging 0.98
R4809:Abl1 UTSW 2 31,690,254 (GRCm39) missense probably damaging 1.00
R4854:Abl1 UTSW 2 31,669,022 (GRCm39) missense probably damaging 1.00
R5345:Abl1 UTSW 2 31,687,059 (GRCm39) missense probably damaging 0.97
R5518:Abl1 UTSW 2 31,680,754 (GRCm39) missense probably damaging 1.00
R5551:Abl1 UTSW 2 31,691,682 (GRCm39) missense probably benign 0.03
R5568:Abl1 UTSW 2 31,669,086 (GRCm39) missense probably damaging 1.00
R5627:Abl1 UTSW 2 31,690,595 (GRCm39) missense probably benign 0.00
R6435:Abl1 UTSW 2 31,691,561 (GRCm39) missense possibly damaging 0.93
R6492:Abl1 UTSW 2 31,691,667 (GRCm39) missense probably benign 0.38
R6738:Abl1 UTSW 2 31,684,586 (GRCm39) missense probably damaging 1.00
R7310:Abl1 UTSW 2 31,690,604 (GRCm39) missense possibly damaging 0.93
R7398:Abl1 UTSW 2 31,680,811 (GRCm39) missense probably damaging 1.00
R7639:Abl1 UTSW 2 31,669,173 (GRCm39) missense probably damaging 1.00
R7674:Abl1 UTSW 2 31,579,841 (GRCm39) missense possibly damaging 0.91
R7781:Abl1 UTSW 2 31,680,709 (GRCm39) missense probably damaging 1.00
R7802:Abl1 UTSW 2 31,650,438 (GRCm39) missense probably benign
R7941:Abl1 UTSW 2 31,579,691 (GRCm39) start gained probably benign
R9743:Abl1 UTSW 2 31,687,716 (GRCm39) missense probably benign 0.34
Z1176:Abl1 UTSW 2 31,579,839 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTCCCTCACCCAAATG -3'
(R):5'- ACTGACAGCTTCTGTTCACCTG -3'

Sequencing Primer
(F):5'- GAGGATCCAGTACCACCTTCTG -3'
(R):5'- GTTCACCTGCCTGGCTTGG -3'
Posted On 2015-01-23