Incidental Mutation 'R2893:Abl1'
ID260650
Institutional Source Beutler Lab
Gene Symbol Abl1
Ensembl Gene ENSMUSG00000026842
Gene Namec-abl oncogene 1, non-receptor tyrosine kinase
Synonymsc-Abl, E430008G22Rik
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31688376-31804227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 31797612 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 521 (S521R)
Ref Sequence ENSEMBL: ENSMUSP00000028190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028190] [ENSMUST00000075759] [ENSMUST00000142554]
PDB Structure
CRYSTAL STRUCTURE OF THE COMPLEX OF THE ABL TYROSINE KINASE SH3 DOMAIN WITH 3BP-1 SYNTHETIC PEPTIDE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE UNLIGANDED ABL TYROSINE KINASE SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF ABL KINASE DOMAIN IN COMPLEX WITH A SMALL MOLECULE INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE C-ABL KINASE DOMAIN IN COMPLEX WITH STI-571. [X-RAY DIFFRACTION]
Crystal Structure of the c-Abl Kinase domain in complex with PD173955 [X-RAY DIFFRACTION]
Structural basis for the auto-inhibition of c-Abl tyrosine kinase [X-RAY DIFFRACTION]
Structural basis for the auto-inhibition of c-Abl tyrosine kinase [X-RAY DIFFRACTION]
Abl kinase domain in complex with NVP-AFG210 [X-RAY DIFFRACTION]
Crystal Structure of Abl kinase bound with PPY-A [X-RAY DIFFRACTION]
Crystal Structure of the T315I Mutant of Abl kinase bound with PPY-A [X-RAY DIFFRACTION]
>> 11 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000028190
AA Change: S521R

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028190
Gene: ENSMUSG00000026842
AA Change: S521R

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
SH3 64 120 6.95e-16 SMART
SH2 125 208 6.52e-32 SMART
TyrKc 242 493 4.48e-149 SMART
low complexity region 698 703 N/A INTRINSIC
low complexity region 802 810 N/A INTRINSIC
low complexity region 883 907 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 964 983 N/A INTRINSIC
FABD 997 1123 1.36e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075759
AA Change: S540R

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075167
Gene: ENSMUSG00000026842
AA Change: S540R

DomainStartEndE-ValueType
SH3 83 139 6.95e-16 SMART
SH2 144 227 6.52e-32 SMART
TyrKc 261 512 4.48e-149 SMART
low complexity region 717 722 N/A INTRINSIC
low complexity region 821 829 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
low complexity region 968 979 N/A INTRINSIC
low complexity region 983 1002 N/A INTRINSIC
FABD 1016 1142 1.36e-63 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127714
Predicted Effect probably benign
Transcript: ENSMUST00000142554
SMART Domains Protein: ENSMUSP00000142123
Gene: ENSMUSG00000026842

DomainStartEndE-ValueType
PDB:1OPL|B 1 47 2e-27 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a protooncogene that encodes a protein tyrosine kinase involved in a variety of cellular processes, including cell division, adhesion, differentiation, and response to stress. The activity of the protein is negatively regulated by its SH3 domain, whereby deletion of the region encoding this domain results in an oncogene. The ubiquitously expressed protein has DNA-binding activity that is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function. This gene has been found fused to a variety of translocation partner genes in various leukemias, most notably the t(9;22) translocation that results in a fusion with the 5' end of the breakpoint cluster region gene (BCR; MIM:151410). Alternative splicing of this gene results in two transcript variants, which contain alternative first exons that are spliced to the remaining common exons. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have increased perinatal and postnatal mortality and may display foreshortened crania, abnormal development of spleen, head, heart and eye, reduced B and T cell populations, and osteoporosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Abl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Abl1 APN 2 31790812 missense probably damaging 1.00
IGL01453:Abl1 APN 2 31778977 missense probably damaging 0.99
IGL02079:Abl1 APN 2 31689948 splice site probably benign
IGL02179:Abl1 APN 2 31792249 missense probably damaging 1.00
IGL02424:Abl1 APN 2 31801132 missense probably benign
IGL02824:Abl1 APN 2 31800819 missense probably damaging 1.00
Hourglass UTSW 2 31794574 missense probably damaging 1.00
Sands UTSW 2 31779010 missense probably damaging 1.00
R0733:Abl1 UTSW 2 31778945 missense probably damaging 1.00
R1222:Abl1 UTSW 2 31800994 missense probably benign
R1428:Abl1 UTSW 2 31801810 missense probably damaging 0.99
R1582:Abl1 UTSW 2 31800359 missense probably damaging 1.00
R1596:Abl1 UTSW 2 31790338 missense probably damaging 0.99
R1824:Abl1 UTSW 2 31800644 missense probably benign 0.01
R2240:Abl1 UTSW 2 31800505 missense probably benign 0.17
R2251:Abl1 UTSW 2 31779119 missense probably damaging 1.00
R2405:Abl1 UTSW 2 31800974 missense possibly damaging 0.50
R3952:Abl1 UTSW 2 31784537 missense probably damaging 1.00
R4119:Abl1 UTSW 2 31801727 missense probably damaging 1.00
R4210:Abl1 UTSW 2 31801696 missense probably damaging 0.98
R4809:Abl1 UTSW 2 31800242 missense probably damaging 1.00
R4854:Abl1 UTSW 2 31779010 missense probably damaging 1.00
R5345:Abl1 UTSW 2 31797047 missense probably damaging 0.97
R5518:Abl1 UTSW 2 31790742 missense probably damaging 1.00
R5551:Abl1 UTSW 2 31801670 missense probably benign 0.03
R5568:Abl1 UTSW 2 31779074 missense probably damaging 1.00
R5627:Abl1 UTSW 2 31800583 missense probably benign 0.00
R6435:Abl1 UTSW 2 31801549 missense possibly damaging 0.93
R6492:Abl1 UTSW 2 31801655 missense probably benign 0.38
R6738:Abl1 UTSW 2 31794574 missense probably damaging 1.00
R7310:Abl1 UTSW 2 31800592 missense possibly damaging 0.93
R7398:Abl1 UTSW 2 31790799 missense probably damaging 1.00
R7639:Abl1 UTSW 2 31779161 missense probably damaging 1.00
R7674:Abl1 UTSW 2 31689829 missense possibly damaging 0.91
R7781:Abl1 UTSW 2 31790697 missense probably damaging 1.00
R7802:Abl1 UTSW 2 31760426 missense probably benign
Z1176:Abl1 UTSW 2 31689827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTCCCTCACCCAAATG -3'
(R):5'- ACTGACAGCTTCTGTTCACCTG -3'

Sequencing Primer
(F):5'- GAGGATCCAGTACCACCTTCTG -3'
(R):5'- GTTCACCTGCCTGGCTTGG -3'
Posted On2015-01-23