Incidental Mutation 'R2893:Slc2a8'
ID260651
Institutional Source Beutler Lab
Gene Symbol Slc2a8
Ensembl Gene ENSMUSG00000026791
Gene Namesolute carrier family 2, (facilitated glucose transporter), member 8
SynonymsD2Ertd44e, GlutX1, GLUT8
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32972990-32982083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32974954 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 394 (W394R)
Ref Sequence ENSEMBL: ENSMUSP00000028129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028129] [ENSMUST00000153484] [ENSMUST00000193695] [ENSMUST00000194066] [ENSMUST00000195863]
Predicted Effect probably damaging
Transcript: ENSMUST00000028129
AA Change: W394R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028129
Gene: ENSMUSG00000026791
AA Change: W394R

DomainStartEndE-ValueType
Pfam:MFS_1 26 425 2e-22 PFAM
Pfam:Sugar_tr 29 474 2.7e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130769
Predicted Effect silent
Transcript: ENSMUST00000153484
SMART Domains Protein: ENSMUSP00000141959
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
Pfam:MFS_1 26 296 1.4e-18 PFAM
Pfam:Sugar_tr 29 295 1.5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191777
Predicted Effect probably benign
Transcript: ENSMUST00000193695
SMART Domains Protein: ENSMUSP00000142100
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
Pfam:MFS_1 26 290 1.2e-18 PFAM
Pfam:Sugar_tr 29 290 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194066
SMART Domains Protein: ENSMUSP00000141969
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195863
SMART Domains Protein: ENSMUSP00000141879
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 60 8.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 2A family, which includes intracellular glucose transporters. Based on sequence comparison, the glucose transporters are grouped into three classes and this gene is a member of class II. The encoded protein, like other members of the family, contains several conserved residues and motifs and 12 transmembrane domains with both amino and carboxyl ends being on the cytosolic side of the membrane. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for one null allele show reduced spermatozoan ATP levels, mitochondrial membrane potential and sperm motility, and a slight deviation from the expected Mendelian frequency. Homozygotes for another null allele show increased hippocampus cell proliferation and cardiac P-wave duration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Slc2a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc2a8 APN 2 32973624 missense probably damaging 0.99
IGL01341:Slc2a8 APN 2 32975991 missense probably damaging 1.00
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0243:Slc2a8 UTSW 2 32980104 intron probably benign
R0530:Slc2a8 UTSW 2 32973684 missense probably benign 0.32
R0972:Slc2a8 UTSW 2 32975367 missense probably benign
R1919:Slc2a8 UTSW 2 32980079 missense probably damaging 1.00
R2015:Slc2a8 UTSW 2 32981380 missense probably benign 0.01
R5144:Slc2a8 UTSW 2 32981773 missense probably damaging 0.96
R5685:Slc2a8 UTSW 2 32981789 missense possibly damaging 0.87
R5744:Slc2a8 UTSW 2 32976028 missense probably benign 0.00
R6717:Slc2a8 UTSW 2 32976177 missense probably damaging 1.00
R7828:Slc2a8 UTSW 2 32980068 nonsense probably null
R7834:Slc2a8 UTSW 2 32976907 missense probably damaging 1.00
R8397:Slc2a8 UTSW 2 32975998 missense probably benign
X0061:Slc2a8 UTSW 2 32975448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCCTACACTCAAGGTCAG -3'
(R):5'- ATCTCCATGACAGCTTGCAAG -3'

Sequencing Primer
(F):5'- CTCAAGGTCAGGGACATGGAATCTC -3'
(R):5'- TTGCAAGCAGGTCCCATC -3'
Posted On2015-01-23