Incidental Mutation 'R2893:Kcnj3'
ID260652
Institutional Source Beutler Lab
Gene Symbol Kcnj3
Ensembl Gene ENSMUSG00000026824
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 3
SynonymsGIRK1, Kcnf3, Kir3.1
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location55435970-55598145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55447015 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 298 (I298F)
Ref Sequence ENSEMBL: ENSMUSP00000108252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067101] [ENSMUST00000112632] [ENSMUST00000112633]
Predicted Effect probably damaging
Transcript: ENSMUST00000067101
AA Change: I298F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063329
Gene: ENSMUSG00000026824
AA Change: I298F

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 385 3.6e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112632
SMART Domains Protein: ENSMUSP00000108251
Gene: ENSMUSG00000026824

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 235 4e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112633
AA Change: I298F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108252
Gene: ENSMUSG00000026824
AA Change: I298F

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 369 1.1e-141 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation display slightly increased resting heart rates, and blunted responses to both indirect vagal activation and direct adenosine A1 receptor activation (intended to activate the muscarinic-gated atrial potassium channel). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Kcnj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnj3 APN 2 55595272 missense possibly damaging 0.88
IGL01889:Kcnj3 APN 2 55437204 missense possibly damaging 0.69
IGL01988:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL01989:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02004:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02035:Kcnj3 APN 2 55437578 missense probably damaging 1.00
R0268:Kcnj3 UTSW 2 55594959 nonsense probably null
R0565:Kcnj3 UTSW 2 55595264 missense probably benign 0.03
R0853:Kcnj3 UTSW 2 55437223 missense possibly damaging 0.69
R1318:Kcnj3 UTSW 2 55437738 missense possibly damaging 0.88
R1592:Kcnj3 UTSW 2 55437886 missense probably damaging 1.00
R1756:Kcnj3 UTSW 2 55437220 missense probably damaging 1.00
R1899:Kcnj3 UTSW 2 55437244 missense probably damaging 1.00
R1966:Kcnj3 UTSW 2 55437331 missense probably damaging 0.99
R2891:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2892:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R3901:Kcnj3 UTSW 2 55437348 missense possibly damaging 0.46
R4470:Kcnj3 UTSW 2 55437865 missense probably damaging 1.00
R4603:Kcnj3 UTSW 2 55446979 nonsense probably null
R4694:Kcnj3 UTSW 2 55594906 missense probably benign 0.00
R4945:Kcnj3 UTSW 2 55437578 missense probably damaging 1.00
R5144:Kcnj3 UTSW 2 55447047 splice site probably null
R5332:Kcnj3 UTSW 2 55437547 missense probably damaging 1.00
R5959:Kcnj3 UTSW 2 55437318 missense probably benign 0.10
R6352:Kcnj3 UTSW 2 55437549 missense probably benign 0.06
R7042:Kcnj3 UTSW 2 55594865 missense possibly damaging 0.87
R7475:Kcnj3 UTSW 2 55437326 missense probably benign 0.09
R7626:Kcnj3 UTSW 2 55594821 nonsense probably null
R7771:Kcnj3 UTSW 2 55446937 missense probably damaging 1.00
R8225:Kcnj3 UTSW 2 55437714 missense probably damaging 1.00
R8558:Kcnj3 UTSW 2 55446863 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCTGAGGGTGAGTTCCTTC -3'
(R):5'- GGCTGATCACAAAATGCCCTAATG -3'

Sequencing Primer
(F):5'- CCCCTTGACCAACTTGAACTGG -3'
(R):5'- TCCTGGGTTATTATCAGGTATATGAC -3'
Posted On2015-01-23