Incidental Mutation 'R2893:Acox3'
ID260661
Institutional Source Beutler Lab
Gene Symbol Acox3
Ensembl Gene ENSMUSG00000029098
Gene Nameacyl-Coenzyme A oxidase 3, pristanoyl
SynonymsEST-s59, pristanoyl-CoA oxidase, PCOX
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location35583040-35615352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35599848 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 344 (I344V)
Ref Sequence ENSEMBL: ENSMUSP00000109876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068563] [ENSMUST00000068947] [ENSMUST00000114237] [ENSMUST00000114238] [ENSMUST00000202266]
Predicted Effect probably benign
Transcript: ENSMUST00000068563
AA Change: I344V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000067178
Gene: ENSMUSG00000029098
AA Change: I344V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 3e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 6e-9 PFAM
Pfam:ACOX 507 662 5.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068947
AA Change: I344V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000063412
Gene: ENSMUSG00000029098
AA Change: I344V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 8.7e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 5.5e-8 PFAM
Pfam:ACOX 510 690 6.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114237
AA Change: I344V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109875
Gene: ENSMUSG00000029098
AA Change: I344V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 5.7e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 9.4e-9 PFAM
Pfam:ACOX 507 695 1.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114238
AA Change: I344V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109876
Gene: ENSMUSG00000029098
AA Change: I344V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 198 309 1.4e-17 PFAM
Pfam:Acyl-CoA_dh_1 340 509 1.3e-7 PFAM
Pfam:ACOX 553 707 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201106
Predicted Effect probably benign
Transcript: ENSMUST00000202266
AA Change: I344V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144499
Gene: ENSMUSG00000029098
AA Change: I344V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 4.5e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 3.2e-8 PFAM
Pfam:ACOX 510 667 1.6e-45 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Acox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Acox3 APN 5 35588752 missense probably benign 0.02
IGL02118:Acox3 APN 5 35601521 missense possibly damaging 0.55
IGL02554:Acox3 APN 5 35608366 missense probably damaging 1.00
IGL03377:Acox3 APN 5 35594332 missense probably damaging 1.00
R1543:Acox3 UTSW 5 35603008 missense probably damaging 1.00
R1661:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1665:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1707:Acox3 UTSW 5 35601564 missense possibly damaging 0.87
R1725:Acox3 UTSW 5 35592172 missense probably benign 0.26
R1763:Acox3 UTSW 5 35608339 splice site probably null
R1851:Acox3 UTSW 5 35609062 missense possibly damaging 0.72
R1923:Acox3 UTSW 5 35592115 missense possibly damaging 0.80
R2154:Acox3 UTSW 5 35605224 missense probably damaging 1.00
R2418:Acox3 UTSW 5 35604638 missense probably benign 0.21
R2892:Acox3 UTSW 5 35594317 missense probably damaging 1.00
R2894:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2964:Acox3 UTSW 5 35605267 missense possibly damaging 0.81
R3431:Acox3 UTSW 5 35589216 missense possibly damaging 0.47
R3735:Acox3 UTSW 5 35611153 missense probably benign 0.02
R3736:Acox3 UTSW 5 35611153 missense probably benign 0.02
R4106:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4107:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4108:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4579:Acox3 UTSW 5 35604643 missense probably damaging 1.00
R4862:Acox3 UTSW 5 35589739 missense probably benign 0.22
R4903:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4949:Acox3 UTSW 5 35612106 missense probably benign 0.06
R4964:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4966:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R5170:Acox3 UTSW 5 35588625 missense probably benign 0.42
R5278:Acox3 UTSW 5 35588156 splice site probably benign
R5569:Acox3 UTSW 5 35603033 missense probably damaging 1.00
R5733:Acox3 UTSW 5 35605199 splice site probably null
R5741:Acox3 UTSW 5 35608324 missense probably benign 0.07
R6530:Acox3 UTSW 5 35588695 missense possibly damaging 0.65
R6580:Acox3 UTSW 5 35608403 missense probably damaging 1.00
R6736:Acox3 UTSW 5 35588854 critical splice donor site probably null
R6848:Acox3 UTSW 5 35592184 missense probably damaging 1.00
R7012:Acox3 UTSW 5 35612087 missense probably benign 0.14
R7233:Acox3 UTSW 5 35605297 missense probably benign 0.01
R7477:Acox3 UTSW 5 35592103 nonsense probably null
R7837:Acox3 UTSW 5 35611486 critical splice acceptor site probably null
R7844:Acox3 UTSW 5 35607148 missense probably benign 0.05
R8799:Acox3 UTSW 5 35589708 missense not run
Z1088:Acox3 UTSW 5 35588222 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCTGACTGATGGGTGACAC -3'
(R):5'- ACATTCAGCAGGCTCATTCC -3'

Sequencing Primer
(F):5'- GGTGACACCCGTCTTTCTTC -3'
(R):5'- GTACCTCCTTTTGAGTATAGTACACC -3'
Posted On2015-01-23