Incidental Mutation 'R2893:Plod3'
ID260663
Institutional Source Beutler Lab
Gene Symbol Plod3
Ensembl Gene ENSMUSG00000004846
Gene Nameprocollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonymslysyl hydroxylase 3, LH3
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136987019-136996648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 136988146 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 50 (A50P)
Ref Sequence ENSEMBL: ENSMUSP00000004968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004968] [ENSMUST00000034953] [ENSMUST00000085941] [ENSMUST00000111090] [ENSMUST00000111091] [ENSMUST00000137272] [ENSMUST00000156963]
Predicted Effect probably benign
Transcript: ENSMUST00000004968
AA Change: A50P

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004968
Gene: ENSMUSG00000004846
AA Change: A50P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 312 324 N/A INTRINSIC
Blast:P4Hc 456 502 2e-8 BLAST
P4Hc 567 740 1.43e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034953
SMART Domains Protein: ENSMUSP00000034953
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085941
SMART Domains Protein: ENSMUSP00000083103
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
Pfam:zf-HIT 113 142 3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102285
Predicted Effect probably benign
Transcript: ENSMUST00000111090
SMART Domains Protein: ENSMUSP00000106719
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 2.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111091
SMART Domains Protein: ENSMUSP00000106720
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
Pfam:zf-HIT 117 146 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127100
SMART Domains Protein: ENSMUSP00000123550
Gene: ENSMUSG00000004846

DomainStartEndE-ValueType
Blast:P4Hc 2 35 2e-11 BLAST
P4Hc 38 200 3.04e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129896
Predicted Effect probably benign
Transcript: ENSMUST00000137272
SMART Domains Protein: ENSMUSP00000120331
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151642
Predicted Effect probably benign
Transcript: ENSMUST00000156963
SMART Domains Protein: ENSMUSP00000115929
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.7e-13 PFAM
Meta Mutation Damage Score 0.1039 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryonic growth, fragility, and fragmented basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Plod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Plod3 APN 5 136996176 missense possibly damaging 0.78
IGL01090:Plod3 APN 5 136990236 missense probably benign 0.37
IGL01443:Plod3 APN 5 136990221 missense probably benign 0.17
IGL01583:Plod3 APN 5 136996148 missense probably benign 0.02
R0544:Plod3 UTSW 5 136991611 missense probably benign 0.09
R0747:Plod3 UTSW 5 136988195 missense probably benign 0.34
R0764:Plod3 UTSW 5 136989583 unclassified probably benign
R1520:Plod3 UTSW 5 136991311 missense probably damaging 0.99
R1631:Plod3 UTSW 5 136988993 missense probably damaging 1.00
R1751:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1767:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1984:Plod3 UTSW 5 136990853 splice site probably null
R1985:Plod3 UTSW 5 136990853 splice site probably null
R2137:Plod3 UTSW 5 136988717 missense probably damaging 1.00
R2148:Plod3 UTSW 5 136987773 nonsense probably null
R2179:Plod3 UTSW 5 136991008 missense possibly damaging 0.77
R2318:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2319:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2512:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2513:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2696:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2891:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3030:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3439:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3957:Plod3 UTSW 5 136994192 missense probably damaging 1.00
R4080:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4081:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4342:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4344:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4345:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4546:Plod3 UTSW 5 136988947 missense possibly damaging 0.94
R4799:Plod3 UTSW 5 136990800 missense probably benign 0.00
R4843:Plod3 UTSW 5 136991000 nonsense probably null
R4956:Plod3 UTSW 5 136989918 missense probably damaging 1.00
R5159:Plod3 UTSW 5 136995078 intron probably benign
R5162:Plod3 UTSW 5 136991307 missense probably damaging 1.00
R5328:Plod3 UTSW 5 136989683 missense probably damaging 1.00
R5427:Plod3 UTSW 5 136991788 missense probably damaging 1.00
R6627:Plod3 UTSW 5 136988456 missense probably damaging 0.99
R7003:Plod3 UTSW 5 136989644 missense probably damaging 1.00
R7132:Plod3 UTSW 5 136995117 missense
R7376:Plod3 UTSW 5 136990481 missense probably benign 0.00
R7404:Plod3 UTSW 5 136995047 missense probably benign
R7827:Plod3 UTSW 5 136989981 missense probably benign
R8062:Plod3 UTSW 5 136990269 missense possibly damaging 0.87
R8506:Plod3 UTSW 5 136988976 missense probably damaging 1.00
R8772:Plod3 UTSW 5 136988919 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTGGAGATCAAATGTGCTGAAAG -3'
(R):5'- ACTGTTCGAGCCACATCACC -3'

Sequencing Primer
(F):5'- TGTGCTGAAAGAACTTTAGTGAAG -3'
(R):5'- CCCAGGGTCTGCAGGAAAGATC -3'
Posted On2015-01-23