Incidental Mutation 'R2893:Atoh8'
ID260664
Institutional Source Beutler Lab
Gene Symbol Atoh8
Ensembl Gene ENSMUSG00000037621
Gene Nameatonal bHLH transcription factor 8
Synonyms4933425C05Rik, okadin, Math6, bHLHa21
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location72206177-72235577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72234872 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 98 (F98Y)
Ref Sequence ENSEMBL: ENSMUSP00000036981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042646] [ENSMUST00000206425]
Predicted Effect probably benign
Transcript: ENSMUST00000042646
AA Change: F98Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036981
Gene: ENSMUSG00000037621
AA Change: F98Y

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 115 138 N/A INTRINSIC
low complexity region 167 175 N/A INTRINSIC
HLH 237 289 1.21e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206553
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele appear to be developmentally arrested at or slightly after gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Atoh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Atoh8 APN 6 72234569 missense probably benign 0.01
IGL02085:Atoh8 APN 6 72235173 unclassified probably benign
R2057:Atoh8 UTSW 6 72235128 missense probably damaging 0.96
R4787:Atoh8 UTSW 6 72223777 missense possibly damaging 0.88
R7529:Atoh8 UTSW 6 72223841 missense probably benign 0.24
Z1177:Atoh8 UTSW 6 72235126 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGAAATTGACGAGTAGGAACTTTC -3'
(R):5'- TTCCGATTGGACTTGGAAGC -3'

Sequencing Primer
(F):5'- CACGGGGGACTCTTGTGG -3'
(R):5'- ATTGGACTTGGAAGCTCCCGAG -3'
Posted On2015-01-23