Incidental Mutation 'R2893:Il4i1'
ID260668
Institutional Source Beutler Lab
Gene Symbol Il4i1
Ensembl Gene ENSMUSG00000074141
Gene Nameinterleukin 4 induced 1
SynonymsFig1-ps, Fig1
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2893 (G1)
Quality Score166
Status Not validated
Chromosome7
Chromosomal Location44816387-44840809 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44837990 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 130 (I130V)
Ref Sequence ENSEMBL: ENSMUSP00000113726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033015] [ENSMUST00000047085] [ENSMUST00000118125] [ENSMUST00000145959]
Predicted Effect probably damaging
Transcript: ENSMUST00000033015
AA Change: I122V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033015
Gene: ENSMUSG00000074141
AA Change: I122V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:AlaDh_PNT_C 42 93 1.3e-9 PFAM
Pfam:Thi4 53 100 1.8e-8 PFAM
Pfam:FAD_binding_3 59 94 1.4e-7 PFAM
Pfam:HI0933_like 59 161 1.3e-8 PFAM
Pfam:FAD_binding_2 60 100 1.5e-8 PFAM
Pfam:Pyr_redox 60 100 1.9e-8 PFAM
Pfam:Pyr_redox_2 60 125 7.3e-8 PFAM
Pfam:DAO 60 140 2.8e-9 PFAM
Pfam:NAD_binding_8 63 130 3.6e-17 PFAM
Pfam:Amino_oxidase 68 503 9.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047085
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118125
AA Change: I130V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141
AA Change: I130V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130081
Predicted Effect probably benign
Transcript: ENSMUST00000133279
SMART Domains Protein: ENSMUSP00000133613
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
PDB:1TDO|A 2 44 1e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139947
Predicted Effect probably benign
Transcript: ENSMUST00000145959
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Il4i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Il4i1 APN 7 44838046 nonsense probably null
IGL03366:Il4i1 APN 7 44837495 unclassified probably benign
R0945:Il4i1 UTSW 7 44839704 missense probably damaging 1.00
R1248:Il4i1 UTSW 7 44839789 missense probably damaging 1.00
R1559:Il4i1 UTSW 7 44839387 missense probably damaging 0.98
R2099:Il4i1 UTSW 7 44838192 critical splice donor site probably null
R2131:Il4i1 UTSW 7 44840070 missense probably damaging 0.98
R2212:Il4i1 UTSW 7 44836658 missense probably damaging 0.99
R2516:Il4i1 UTSW 7 44839891 missense probably damaging 1.00
R3412:Il4i1 UTSW 7 44836658 missense probably damaging 0.99
R3414:Il4i1 UTSW 7 44836658 missense probably damaging 0.99
R5493:Il4i1 UTSW 7 44840053 missense possibly damaging 0.56
R6156:Il4i1 UTSW 7 44840184 missense possibly damaging 0.53
R6239:Il4i1 UTSW 7 44840412 missense probably benign
R6422:Il4i1 UTSW 7 44840136 missense probably damaging 0.99
R6813:Il4i1 UTSW 7 44839812 missense probably benign 0.44
R6866:Il4i1 UTSW 7 44836539 critical splice donor site probably null
R7543:Il4i1 UTSW 7 44836775 missense possibly damaging 0.79
R7673:Il4i1 UTSW 7 44840362 missense probably benign
R7965:Il4i1 UTSW 7 44840395 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGTCAAAAGTTGGGTCTAG -3'
(R):5'- ACCTTGTTGAGTGCCATCTG -3'

Sequencing Primer
(F):5'- TCAGTAATGCCTTCCGGAGAG -3'
(R):5'- ATCTGGTAGATGTCCTCTGGG -3'
Posted On2015-01-23