Incidental Mutation 'R2893:Olfr632'
ID260670
Institutional Source Beutler Lab
Gene Symbol Olfr632
Ensembl Gene ENSMUSG00000073938
Gene Nameolfactory receptor 632
SynonymsGA_x6K02T2PBJ9-6671256-6672209, MOR2-1
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103934347-103940579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103938182 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 267 (R267S)
Ref Sequence ENSEMBL: ENSMUSP00000149598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098189] [ENSMUST00000214711]
Predicted Effect probably damaging
Transcript: ENSMUST00000098189
AA Change: R267S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095791
Gene: ENSMUSG00000073938
AA Change: R267S

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 2.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 39 232 7.5e-11 PFAM
Pfam:7tm_1 45 296 1.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214509
Predicted Effect probably damaging
Transcript: ENSMUST00000214711
AA Change: R267S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Olfr632
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr632 APN 7 103937575 missense possibly damaging 0.88
IGL01817:Olfr632 APN 7 103937823 missense probably benign 0.01
IGL02303:Olfr632 APN 7 103937563 missense possibly damaging 0.62
IGL03392:Olfr632 APN 7 103938025 missense probably benign 0.01
R0092:Olfr632 UTSW 7 103937727 missense probably damaging 1.00
R0492:Olfr632 UTSW 7 103937764 missense probably benign 0.05
R0711:Olfr632 UTSW 7 103937817 missense probably benign 0.29
R3911:Olfr632 UTSW 7 103937409 missense possibly damaging 0.94
R4825:Olfr632 UTSW 7 103937503 missense probably benign 0.02
R6106:Olfr632 UTSW 7 103938193 missense probably benign 0.05
R6254:Olfr632 UTSW 7 103937534 missense probably benign 0.07
R6383:Olfr632 UTSW 7 103937823 missense probably benign 0.01
R6821:Olfr632 UTSW 7 103937586 missense probably benign 0.07
R6890:Olfr632 UTSW 7 103937859 missense possibly damaging 0.71
R7646:Olfr632 UTSW 7 103938297 missense probably damaging 0.98
R8041:Olfr632 UTSW 7 103937581 missense probably damaging 1.00
R8232:Olfr632 UTSW 7 103937773 missense possibly damaging 0.65
R8266:Olfr632 UTSW 7 103937539 missense probably damaging 0.96
R8326:Olfr632 UTSW 7 103937602 missense probably damaging 1.00
R8783:Olfr632 UTSW 7 103937544 missense not run
Z1177:Olfr632 UTSW 7 103937758 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCATGGGTTCAGATGTCCTC -3'
(R):5'- CACTTCTCTGCTGAAAGGACTC -3'

Sequencing Primer
(F):5'- ATGGGTTCAGATGTCCTCTTCATC -3'
(R):5'- TCTCTGCTGAAAGGACTCTGAAAAG -3'
Posted On2015-01-23