Incidental Mutation 'R2893:F11'
ID260671
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Namecoagulation factor XI
SynonymsFXI, plasma thromboplastin antecedent, Cf11, 1600027G01Rik
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45241174-45262031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45248638 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 353 (S353P)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
Predicted Effect probably damaging
Transcript: ENSMUST00000034064
AA Change: S353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: S353P

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210622
Meta Mutation Damage Score 0.5090 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45250095 missense probably damaging 1.00
IGL02096:F11 APN 8 45246754 missense probably benign 0.05
IGL02363:F11 APN 8 45241531 missense probably damaging 1.00
IGL02694:F11 APN 8 45252159 missense probably damaging 1.00
IGL03374:F11 APN 8 45261074 missense possibly damaging 0.63
R0225:F11 UTSW 8 45249077 missense probably benign 0.00
R0525:F11 UTSW 8 45253049 missense probably benign 0.01
R0842:F11 UTSW 8 45252159 missense probably damaging 1.00
R0961:F11 UTSW 8 45241494 missense probably damaging 1.00
R1605:F11 UTSW 8 45241580 missense probably damaging 1.00
R2044:F11 UTSW 8 45252118 missense probably benign 0.03
R2113:F11 UTSW 8 45246832 missense probably benign 0.00
R2273:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2274:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2275:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2318:F11 UTSW 8 45248638 missense probably damaging 1.00
R2319:F11 UTSW 8 45248638 missense probably damaging 1.00
R2403:F11 UTSW 8 45248638 missense probably damaging 1.00
R2510:F11 UTSW 8 45248638 missense probably damaging 1.00
R2512:F11 UTSW 8 45261061 missense probably benign 0.01
R2894:F11 UTSW 8 45248638 missense probably damaging 1.00
R2910:F11 UTSW 8 45241449 makesense probably null
R3030:F11 UTSW 8 45248638 missense probably damaging 1.00
R3105:F11 UTSW 8 45245717 missense probably damaging 0.97
R3721:F11 UTSW 8 45248638 missense probably damaging 1.00
R3726:F11 UTSW 8 45248638 missense probably damaging 1.00
R3906:F11 UTSW 8 45248638 missense probably damaging 1.00
R3909:F11 UTSW 8 45248638 missense probably damaging 1.00
R4465:F11 UTSW 8 45241474 missense probably damaging 1.00
R4467:F11 UTSW 8 45241474 missense probably damaging 1.00
R4710:F11 UTSW 8 45250146 missense probably damaging 1.00
R4824:F11 UTSW 8 45255342 missense probably damaging 0.99
R4968:F11 UTSW 8 45245733 missense probably benign 0.19
R5225:F11 UTSW 8 45255304 missense probably benign 0.09
R5288:F11 UTSW 8 45246796 missense probably damaging 1.00
R5378:F11 UTSW 8 45252143 missense probably benign 0.19
R6155:F11 UTSW 8 45252082 missense probably damaging 1.00
R6213:F11 UTSW 8 45241500 missense probably damaging 1.00
R6615:F11 UTSW 8 45248774 missense probably benign
R6797:F11 UTSW 8 45253055 missense probably benign 0.02
R7147:F11 UTSW 8 45250146 missense probably damaging 1.00
R7683:F11 UTSW 8 45249508 missense probably damaging 0.97
R7688:F11 UTSW 8 45250090 missense probably damaging 1.00
R7720:F11 UTSW 8 45252090 missense possibly damaging 0.89
R8064:F11 UTSW 8 45245773 missense probably benign 0.01
U24488:F11 UTSW 8 45242312 missense probably benign 0.04
Z1088:F11 UTSW 8 45245772 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCTATGGTTGTTGTAGACTAGCCTC -3'
(R):5'- GAGAAGAGCTGGACATCGTC -3'

Sequencing Primer
(F):5'- ACTAGCCTCGTGTAGTAGACTAGC -3'
(R):5'- CATCGTCGATGTGAAAGGCC -3'
Posted On2015-01-23