Incidental Mutation 'R2893:Islr2'
ID260673
Institutional Source Beutler Lab
Gene Symbol Islr2
Ensembl Gene ENSMUSG00000051243
Gene Nameimmunoglobulin superfamily containing leucine-rich repeat 2
SynonymsLinx, mbu-3, B930052A04Rik
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58196297-58204319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58197866 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 704 (S704T)
Ref Sequence ENSEMBL: ENSMUSP00000149095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114144] [ENSMUST00000163200] [ENSMUST00000163897] [ENSMUST00000165276] [ENSMUST00000170421] [ENSMUST00000214647] [ENSMUST00000214649] [ENSMUST00000215950] [ENSMUST00000216231] [ENSMUST00000216297] [ENSMUST00000217578] [ENSMUST00000217427] [ENSMUST00000217050] [ENSMUST00000217512]
Predicted Effect probably damaging
Transcript: ENSMUST00000114144
AA Change: S704T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109781
Gene: ENSMUSG00000051243
AA Change: S704T

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163200
AA Change: S748T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130879
Gene: ENSMUSG00000051243
AA Change: S748T

DomainStartEndE-ValueType
LRRNT 63 99 1.1e-1 SMART
LRR 93 117 8.24e0 SMART
LRR 142 165 1.91e1 SMART
LRR 166 189 3.07e-1 SMART
LRR_TYP 190 213 1.58e-3 SMART
LRRCT 225 275 2.36e-12 SMART
IG 289 418 2.99e-2 SMART
low complexity region 554 579 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
low complexity region 706 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163897
AA Change: S704T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130322
Gene: ENSMUSG00000051243
AA Change: S704T

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165276
AA Change: S704T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129328
Gene: ENSMUSG00000051243
AA Change: S704T

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170421
AA Change: S704T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127228
Gene: ENSMUSG00000051243
AA Change: S704T

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213495
Predicted Effect probably benign
Transcript: ENSMUST00000214647
Predicted Effect probably benign
Transcript: ENSMUST00000214649
Predicted Effect probably damaging
Transcript: ENSMUST00000215950
AA Change: S704T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000216231
Predicted Effect probably benign
Transcript: ENSMUST00000216297
Predicted Effect probably benign
Transcript: ENSMUST00000217578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217158
Predicted Effect probably benign
Transcript: ENSMUST00000217427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216359
Predicted Effect probably benign
Transcript: ENSMUST00000217050
Predicted Effect probably benign
Transcript: ENSMUST00000217512
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, absent tail pinch response, and defective peroneal and tibial nerve morphology and branch extension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Islr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Islr2 APN 9 58199786 missense probably benign 0.03
IGL01444:Islr2 APN 9 58198378 missense probably damaging 1.00
R0346:Islr2 UTSW 9 58198343 nonsense probably null
R0360:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0364:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0528:Islr2 UTSW 9 58199362 missense probably damaging 0.97
R0693:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R1854:Islr2 UTSW 9 58199816 missense probably damaging 0.97
R3747:Islr2 UTSW 9 58199642 missense probably benign 0.00
R3914:Islr2 UTSW 9 58198383 nonsense probably null
R4176:Islr2 UTSW 9 58199900 missense probably damaging 1.00
R4212:Islr2 UTSW 9 58199320 missense probably damaging 1.00
R4844:Islr2 UTSW 9 58208234 unclassified probably benign
R5303:Islr2 UTSW 9 58208275 unclassified probably benign
R5636:Islr2 UTSW 9 58201301 missense probably benign 0.03
R5787:Islr2 UTSW 9 58198354 missense probably damaging 0.97
R5883:Islr2 UTSW 9 58198715 missense probably benign 0.01
R6406:Islr2 UTSW 9 58199980 missense probably benign
R7105:Islr2 UTSW 9 58197814 missense probably damaging 1.00
R7130:Islr2 UTSW 9 58198292 missense probably damaging 1.00
R7316:Islr2 UTSW 9 58197967 missense probably damaging 0.99
X0026:Islr2 UTSW 9 58198286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGTCCTGCCGTCCCTAG -3'
(R):5'- CCTATGGAGAAACGCATCGC -3'

Sequencing Primer
(F):5'- CTAGGCTACGAGGTACCCAAG -3'
(R):5'- CGATTTCGATCCGCGTGC -3'
Posted On2015-01-23