Incidental Mutation 'R2893:Vmn2r80'
ID260675
Institutional Source Beutler Lab
Gene Symbol Vmn2r80
Ensembl Gene ENSMUSG00000091888
Gene Namevomeronasal 2, receptor 80
SynonymsEG624765
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79148797-79195012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79148865 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 17 (F17S)
Ref Sequence ENSEMBL: ENSMUSP00000132299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165834]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165834
AA Change: F17S

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132299
Gene: ENSMUSG00000091888
AA Change: F17S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 474 1.5e-36 PFAM
Pfam:NCD3G 517 570 7.9e-22 PFAM
Pfam:7tm_3 603 838 6.2e-49 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Fam160b1 C T 19: 57,384,169 P617L probably benign Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Other mutations in Vmn2r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Vmn2r80 APN 10 79194599 missense probably damaging 1.00
IGL01325:Vmn2r80 APN 10 79194247 missense possibly damaging 0.62
IGL01611:Vmn2r80 APN 10 79171654 missense probably damaging 1.00
IGL01799:Vmn2r80 APN 10 79171551 missense possibly damaging 0.95
IGL01877:Vmn2r80 APN 10 79171500 splice site probably null
IGL02673:Vmn2r80 APN 10 79169484 missense probably benign 0.02
IGL02756:Vmn2r80 APN 10 79194311 missense probably damaging 1.00
IGL02820:Vmn2r80 APN 10 79171605 missense probably benign 0.04
IGL03382:Vmn2r80 APN 10 79169528 missense probably damaging 1.00
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0129:Vmn2r80 UTSW 10 79169496 missense probably damaging 1.00
R0325:Vmn2r80 UTSW 10 79148939 missense possibly damaging 0.89
R0567:Vmn2r80 UTSW 10 79194831 missense possibly damaging 0.89
R1510:Vmn2r80 UTSW 10 79169719 missense possibly damaging 0.69
R1519:Vmn2r80 UTSW 10 79194219 missense probably damaging 1.00
R1520:Vmn2r80 UTSW 10 79194760 missense probably damaging 1.00
R1627:Vmn2r80 UTSW 10 79194415 missense probably damaging 1.00
R1709:Vmn2r80 UTSW 10 79194389 missense probably benign 0.04
R2116:Vmn2r80 UTSW 10 79194724 missense probably benign 0.09
R2237:Vmn2r80 UTSW 10 79168270 missense probably damaging 1.00
R2308:Vmn2r80 UTSW 10 79171621 missense probably damaging 1.00
R3408:Vmn2r80 UTSW 10 79168393 missense possibly damaging 0.95
R4502:Vmn2r80 UTSW 10 79148930 missense probably benign 0.00
R4685:Vmn2r80 UTSW 10 79194328 missense possibly damaging 0.95
R4851:Vmn2r80 UTSW 10 79194322 missense possibly damaging 0.68
R4947:Vmn2r80 UTSW 10 79194698 missense probably damaging 1.00
R5112:Vmn2r80 UTSW 10 79194458 missense possibly damaging 0.61
R5217:Vmn2r80 UTSW 10 79169146 missense possibly damaging 0.62
R5226:Vmn2r80 UTSW 10 79194040 missense probably benign 0.36
R5512:Vmn2r80 UTSW 10 79168232 missense probably benign 0.00
R5618:Vmn2r80 UTSW 10 79148921 missense probably benign
R5959:Vmn2r80 UTSW 10 79169479 missense probably benign 0.00
R6104:Vmn2r80 UTSW 10 79149020 missense probably benign 0.00
R6110:Vmn2r80 UTSW 10 79182003 missense probably damaging 1.00
R6270:Vmn2r80 UTSW 10 79194325 missense probably benign 0.00
R6508:Vmn2r80 UTSW 10 79194456 missense probably benign 0.03
R6843:Vmn2r80 UTSW 10 79169668 missense probably benign 0.08
R6894:Vmn2r80 UTSW 10 79169604 missense probably benign 0.06
R7048:Vmn2r80 UTSW 10 79194319 missense probably damaging 1.00
R7149:Vmn2r80 UTSW 10 79194820 missense probably benign 0.00
R7262:Vmn2r80 UTSW 10 79169745 missense probably damaging 0.98
R7559:Vmn2r80 UTSW 10 79194625 missense probably benign 0.00
R7622:Vmn2r80 UTSW 10 79194263 missense probably damaging 1.00
R8003:Vmn2r80 UTSW 10 79148877 missense probably benign 0.16
R8207:Vmn2r80 UTSW 10 79194316 nonsense probably null
R8330:Vmn2r80 UTSW 10 79171716 missense probably damaging 1.00
R8337:Vmn2r80 UTSW 10 79148873 missense probably benign 0.00
R8354:Vmn2r80 UTSW 10 79148876 missense probably benign
R8688:Vmn2r80 UTSW 10 79168235 missense not run
Z1176:Vmn2r80 UTSW 10 79169477 missense not run
Z1176:Vmn2r80 UTSW 10 79194398 missense possibly damaging 0.65
Z1176:Vmn2r80 UTSW 10 79194607 missense probably damaging 1.00
Z1176:Vmn2r80 UTSW 10 79194771 missense probably damaging 1.00
Z1177:Vmn2r80 UTSW 10 79169477 missense not run
Predicted Primers PCR Primer
(F):5'- AAGGATCCCTGAAAACGTCTC -3'
(R):5'- ATATATGGAGCCTCGTGATGAG -3'

Sequencing Primer
(F):5'- GGATCCCTGAAAACGTCTCTAGATG -3'
(R):5'- CGTGATGAGAAATACTTGGGAAAATG -3'
Posted On2015-01-23