Mutagenetix > Incidental Mutations

Incidental Mutation 'R2893:Vmn2r114'

260681

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r114

Ensembl Gene

ENSMUSG00000091945

Gene Name

vomeronasal 2, receptor 114

Synonyms

EG666002

MMRRC Submission

040481-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R2893 (G1)

Quality Score

108

Status

Not validated

Chromosome

Chromosomal Location

23290934-23312313 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

ATTT to ATT at 23290932 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168033]

Predicted Effect

probably null
Transcript: ENSMUST00000168033

SMART Domains

Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	154	470	1.5e-24	PFAM
Pfam:NCD3G	511	564	1.5e-18	PFAM
Pfam:7tm_3	597	832	1.4e-55	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Abl1	T	G	2: 31,797,612	S521R	probably benign	Het
Acox3	A	G	5: 35,599,848	I344V	probably benign	Het
Ank2	T	C	3: 127,248,243		probably null	Het
Atoh8	A	T	6: 72,234,872	F98Y	probably benign	Het
Caskin2	C	T	11: 115,801,277	G894E	probably benign	Het
Cdh15	G	A	8: 122,856,635	R59H	probably benign	Het
Cdk5rap2	T	C	4: 70,289,873	K779E	probably benign	Het
Csmd2	T	A	4: 128,538,993		probably null	Het
Cubn	T	C	2: 13,358,139	D1687G	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Faap100	T	C	11: 120,374,625	D475G	probably damaging	Het
Fam160b1	C	T	19: 57,384,169	P617L	probably benign	Het
Gm13090	T	A	4: 151,090,700	L78*	probably null	Het
Gm8394	T	C	10: 85,313,984		noncoding transcript	Het
Ikbke	G	A	1: 131,270,224	P382S	probably damaging	Het
Il4i1	A	G	7: 44,837,990	I130V	probably damaging	Het
Islr2	A	T	9: 58,197,866	S704T	probably damaging	Het
Itga10	A	G	3: 96,655,100	N733D	probably benign	Het
Itih2	C	T	2: 10,102,197	G662D	possibly damaging	Het
Kansl1l	T	C	1: 66,801,334	Q269R	probably damaging	Het
Kcnj3	A	T	2: 55,447,015	I298F	probably damaging	Het
Kdr	A	G	5: 75,946,836	F1016L	probably damaging	Het
Miga2	A	T	2: 30,378,294		probably null	Het
Olfr632	A	T	7: 103,938,182	R267S	probably damaging	Het
Per2	C	A	1: 91,445,603	Q154H	probably damaging	Het
Pik3ap1	G	A	19: 41,376,061	A73V	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Rad18	G	A	6: 112,675,773	Q288*	probably null	Het
Rapsn	A	T	2: 91,036,824	D157V	probably damaging	Het
Slc2a8	A	T	2: 32,974,954	W394R	probably damaging	Het
Srcap	T	C	7: 127,539,065	S1136P	probably damaging	Het
Tenm4	T	A	7: 96,894,990	V2108D	probably damaging	Het
Trappc10	C	T	10: 78,193,401	V1101M	probably benign	Het
Ttbk2	C	A	2: 120,745,610		probably null	Het
Usp8	A	T	2: 126,758,155	Q998L	probably damaging	Het
Vmn2r80	T	C	10: 79,148,865	F17S	possibly damaging	Het

Other mutations in Vmn2r114

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Vmn2r114	APN	17	23291665	missense	probably damaging	1.00
IGL00990:Vmn2r114	APN	17	23290965	missense	probably benign
IGL00990:Vmn2r114	APN	17	23290983	missense	probably benign	0.23
IGL00990:Vmn2r114	APN	17	23291238	missense	probably damaging	1.00
IGL01838:Vmn2r114	APN	17	23296982	missense	probably benign	0.44
IGL01990:Vmn2r114	APN	17	23310381	missense	probably benign	0.22
IGL01994:Vmn2r114	APN	17	23310477	missense	probably damaging	1.00
IGL02153:Vmn2r114	APN	17	23291808	missense	probably benign	0.01
IGL02453:Vmn2r114	APN	17	23311134	missense	probably benign	0.00
IGL02621:Vmn2r114	APN	17	23310520	missense	probably damaging	0.98
IGL02938:Vmn2r114	APN	17	23291289	missense	probably benign	0.10
IGL03130:Vmn2r114	APN	17	23296996	splice site	probably benign
IGL03325:Vmn2r114	APN	17	23291678	missense	probably damaging	1.00
BB004:Vmn2r114	UTSW	17	23291645	missense	probably damaging	1.00
R0109:Vmn2r114	UTSW	17	23310575	nonsense	probably null
R0164:Vmn2r114	UTSW	17	23309826	critical splice donor site	probably null
R0310:Vmn2r114	UTSW	17	23290943	missense	probably benign	0.23
R0583:Vmn2r114	UTSW	17	23290932	makesense	probably null
R0677:Vmn2r114	UTSW	17	23310594	missense	probably damaging	1.00
R1127:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1147:Vmn2r114	UTSW	17	23311063	missense	probably benign	0.00
R1147:Vmn2r114	UTSW	17	23311063	missense	probably benign	0.00
R1157:Vmn2r114	UTSW	17	23310340	missense	possibly damaging	0.60
R1323:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1347:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1435:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1437:Vmn2r114	UTSW	17	23291211	missense	probably damaging	1.00
R1585:Vmn2r114	UTSW	17	23291701	missense	probably damaging	0.98
R1641:Vmn2r114	UTSW	17	23296988	missense	probably benign	0.00
R1748:Vmn2r114	UTSW	17	23308061	missense	probably benign	0.17
R1954:Vmn2r114	UTSW	17	23311112	missense	probably benign	0.32
R2081:Vmn2r114	UTSW	17	23291109	missense	possibly damaging	0.91
R2103:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2113:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2134:Vmn2r114	UTSW	17	23291763	missense	probably damaging	1.00
R2149:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2424:Vmn2r114	UTSW	17	23296868	missense	possibly damaging	0.90
R2847:Vmn2r114	UTSW	17	23290974	missense	probably benign	0.00
R2848:Vmn2r114	UTSW	17	23290974	missense	probably benign	0.00
R3017:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3018:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3019:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3020:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3021:Vmn2r114	UTSW	17	23290932	makesense	probably null
R4628:Vmn2r114	UTSW	17	23290932	makesense	probably null
R4668:Vmn2r114	UTSW	17	23310473	missense	possibly damaging	0.83
R4840:Vmn2r114	UTSW	17	23291379	missense	probably damaging	0.97
R4841:Vmn2r114	UTSW	17	23310362	missense	probably benign	0.04
R4842:Vmn2r114	UTSW	17	23310362	missense	probably benign	0.04
R4856:Vmn2r114	UTSW	17	23308034	missense	probably benign	0.11
R4886:Vmn2r114	UTSW	17	23308034	missense	probably benign	0.11
R4992:Vmn2r114	UTSW	17	23291791	missense	probably benign	0.03
R5182:Vmn2r114	UTSW	17	23291658	missense	probably damaging	0.96
R5223:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5405:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5449:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5615:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5834:Vmn2r114	UTSW	17	23310625	missense	possibly damaging	0.90
R6150:Vmn2r114	UTSW	17	23291295	missense	probably benign	0.03
R6277:Vmn2r114	UTSW	17	23290980	missense	possibly damaging	0.93
R6403:Vmn2r114	UTSW	17	23309965	missense	probably damaging	0.99
R6589:Vmn2r114	UTSW	17	23291668	missense	probably damaging	1.00
R6613:Vmn2r114	UTSW	17	23310246	missense	possibly damaging	0.82
R6747:Vmn2r114	UTSW	17	23309876	missense	probably benign	0.00
R6837:Vmn2r114	UTSW	17	23310202	missense	probably benign	0.10
R6911:Vmn2r114	UTSW	17	23291130	missense	probably damaging	0.98
R6950:Vmn2r114	UTSW	17	23310163	missense	probably benign	0.03
R7276:Vmn2r114	UTSW	17	23290960	missense	probably damaging	0.97
R7482:Vmn2r114	UTSW	17	23291494	missense	probably damaging	1.00
R7514:Vmn2r114	UTSW	17	23308061	missense	probably null	0.96
R7523:Vmn2r114	UTSW	17	23310637	missense	probably benign	0.01
R7563:Vmn2r114	UTSW	17	23291026	missense	probably benign	0.01
R7585:Vmn2r114	UTSW	17	23291265	missense	probably damaging	1.00
R7593:Vmn2r114	UTSW	17	23291843	nonsense	probably null
R7611:Vmn2r114	UTSW	17	23296970	missense	probably damaging	0.97
R7641:Vmn2r114	UTSW	17	23308203	missense	possibly damaging	0.53
R7651:Vmn2r114	UTSW	17	23291012	nonsense	probably null
R7970:Vmn2r114	UTSW	17	23311212	missense	probably benign	0.00
R8737:Vmn2r114	UTSW	17	23310168	missense	probably benign	0.36
R8802:Vmn2r114	UTSW	17	23309862	missense	not run
X0065:Vmn2r114	UTSW	17	23310957	missense	probably benign	0.34
Z1088:Vmn2r114	UTSW	17	23290932	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- CTCCCAGTGTAAAGATTTTGTCAC -3'
(R):5'- TTACCATAGCACCAAAGGCAGG -3'

Sequencing Primer
(F):5'- CAGGCCATGATTATATCTGCAGAGAC -3'
(R):5'- CACCAAAGGCAGGGTCATG -3'

Posted On

2015-01-23