Incidental Mutation 'R2893:Fam160b1'
ID260683
Institutional Source Beutler Lab
Gene Symbol Fam160b1
Ensembl Gene ENSMUSG00000033478
Gene Namefamily with sequence similarity 160, member B1
Synonyms
MMRRC Submission 040481-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R2893 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location57361009-57389594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57384169 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 617 (P617L)
Ref Sequence ENSEMBL: ENSMUSP00000048903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036407]
Predicted Effect probably benign
Transcript: ENSMUST00000036407
AA Change: P617L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048903
Gene: ENSMUSG00000033478
AA Change: P617L

DomainStartEndE-ValueType
Pfam:RAI16-like 78 495 1.1e-144 PFAM
low complexity region 713 724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abl1 T G 2: 31,797,612 S521R probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Atoh8 A T 6: 72,234,872 F98Y probably benign Het
Caskin2 C T 11: 115,801,277 G894E probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Csmd2 T A 4: 128,538,993 probably null Het
Cubn T C 2: 13,358,139 D1687G possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Faap100 T C 11: 120,374,625 D475G probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm8394 T C 10: 85,313,984 noncoding transcript Het
Ikbke G A 1: 131,270,224 P382S probably damaging Het
Il4i1 A G 7: 44,837,990 I130V probably damaging Het
Islr2 A T 9: 58,197,866 S704T probably damaging Het
Itga10 A G 3: 96,655,100 N733D probably benign Het
Itih2 C T 2: 10,102,197 G662D possibly damaging Het
Kansl1l T C 1: 66,801,334 Q269R probably damaging Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Olfr632 A T 7: 103,938,182 R267S probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Slc2a8 A T 2: 32,974,954 W394R probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Tenm4 T A 7: 96,894,990 V2108D probably damaging Het
Trappc10 C T 10: 78,193,401 V1101M probably benign Het
Ttbk2 C A 2: 120,745,610 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r80 T C 10: 79,148,865 F17S possibly damaging Het
Other mutations in Fam160b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fam160b1 APN 19 57381345 missense probably benign 0.00
IGL02642:Fam160b1 APN 19 57385350 missense possibly damaging 0.55
IGL03152:Fam160b1 APN 19 57378832 missense probably damaging 0.99
fredericksburg UTSW 19 57384123 nonsense probably null
R0001:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R0123:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0368:Fam160b1 UTSW 19 57368578 missense possibly damaging 0.91
R0446:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0508:Fam160b1 UTSW 19 57378742 missense probably benign 0.04
R0926:Fam160b1 UTSW 19 57381090 missense probably damaging 1.00
R1122:Fam160b1 UTSW 19 57382301 missense probably benign 0.00
R1344:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1398:Fam160b1 UTSW 19 57372926 splice site probably benign
R1418:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1506:Fam160b1 UTSW 19 57368575 missense probably benign 0.30
R1530:Fam160b1 UTSW 19 57386305 missense probably damaging 0.99
R1695:Fam160b1 UTSW 19 57379171 missense probably damaging 1.00
R1868:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R1974:Fam160b1 UTSW 19 57385377 missense probably damaging 0.99
R2004:Fam160b1 UTSW 19 57381892 missense probably benign
R3011:Fam160b1 UTSW 19 57385288 missense probably damaging 1.00
R3963:Fam160b1 UTSW 19 57373010 missense possibly damaging 0.77
R4416:Fam160b1 UTSW 19 57385397 splice site probably null
R4613:Fam160b1 UTSW 19 57371187 missense probably damaging 0.99
R4735:Fam160b1 UTSW 19 57371229 missense probably damaging 1.00
R4893:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R4937:Fam160b1 UTSW 19 57378637 missense probably benign
R5049:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R5050:Fam160b1 UTSW 19 57383170 missense probably damaging 1.00
R5080:Fam160b1 UTSW 19 57373281 missense probably damaging 1.00
R5176:Fam160b1 UTSW 19 57371181 missense probably damaging 0.98
R5317:Fam160b1 UTSW 19 57381709 splice site probably null
R5347:Fam160b1 UTSW 19 57378619 missense probably benign
R5497:Fam160b1 UTSW 19 57381151 splice site probably null
R5969:Fam160b1 UTSW 19 57384123 nonsense probably null
R6418:Fam160b1 UTSW 19 57381734 missense probably benign 0.18
R6426:Fam160b1 UTSW 19 57383178 missense probably damaging 1.00
R6765:Fam160b1 UTSW 19 57378745 missense probably benign
R7472:Fam160b1 UTSW 19 57368585 missense probably damaging 1.00
R7583:Fam160b1 UTSW 19 57378602 missense probably benign 0.01
R7672:Fam160b1 UTSW 19 57385318 missense possibly damaging 0.95
X0023:Fam160b1 UTSW 19 57384147 nonsense probably null
X0062:Fam160b1 UTSW 19 57385257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGCTCAGTGTGACGATC -3'
(R):5'- AGCTGTAGGCACTCACAAC -3'

Sequencing Primer
(F):5'- GGCTCAGTGTGACGATCCCTATC -3'
(R):5'- GCTGTAGGCACTCACAACCTATG -3'
Posted On2015-01-23