Incidental Mutation 'R2894:Fmo6'
ID260686
Institutional Source Beutler Lab
Gene Symbol Fmo6
Ensembl Gene ENSMUSG00000095576
Gene Nameflavin containing monooxygenase 6
Synonyms
MMRRC Submission 040482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2894 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162916551-162937515 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 162922724 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 254 (W254*)
Ref Sequence ENSEMBL: ENSMUSP00000136378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178465] [ENSMUST00000195576]
Predicted Effect probably null
Transcript: ENSMUST00000178465
AA Change: W254*
SMART Domains Protein: ENSMUSP00000136378
Gene: ENSMUSG00000095576
AA Change: W254*

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 3.2e-273 PFAM
Pfam:Pyr_redox_2 3 226 2e-13 PFAM
Pfam:Pyr_redox_3 6 220 4.6e-17 PFAM
Pfam:K_oxygenase 79 223 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195576
SMART Domains Protein: ENSMUSP00000144106
Gene: ENSMUSG00000095576

DomainStartEndE-ValueType
Pfam:FMO-like 2 118 5.1e-58 PFAM
Pfam:NAD_binding_8 7 84 2.2e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Ccl4 C A 11: 83,663,503 probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Cenpu C A 8: 46,576,349 N212K probably damaging Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Dnah1 T A 14: 31,298,761 E1217V possibly damaging Het
Dusp15 T C 2: 152,949,085 I31V probably benign Het
Ern2 A C 7: 122,181,587 S114A possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm16494 T C 17: 47,016,706 E84G unknown Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Mdga1 T C 17: 29,852,504 Y381C probably damaging Het
Msh3 G T 13: 92,342,360 A367D probably benign Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr558 A G 7: 102,709,675 T139A probably damaging Het
Olfr847 A T 9: 19,375,292 Y196* probably null Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Pramef25 A T 4: 143,949,122 M378K probably damaging Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rarb T C 14: 16,435,146 D300G probably damaging Het
Ruvbl1 C T 6: 88,479,132 R63W possibly damaging Het
Setdb2 T C 14: 59,426,467 N77S probably benign Het
Slc22a19 C A 19: 7,692,804 K228N probably benign Het
Thoc6 A G 17: 23,669,035 S292P probably damaging Het
Tmem126b A T 7: 90,470,913 S83R probably damaging Het
Tmem232 C T 17: 65,450,413 E262K probably damaging Het
Vmn2r60 T C 7: 42,135,796 V144A probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwa8 A G 14: 79,038,138 N787S probably damaging Het
Other mutations in Fmo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Fmo6 APN 1 162930011 nonsense probably null
IGL02083:Fmo6 APN 1 162920464 nonsense probably null
adventure UTSW 1 162922810 missense probably benign
R0792:Fmo6 UTSW 1 162920563 missense probably damaging 0.98
R0940:Fmo6 UTSW 1 162926226 missense probably benign 0.07
R1173:Fmo6 UTSW 1 162926141 missense probably damaging 1.00
R1268:Fmo6 UTSW 1 162920517 missense probably damaging 1.00
R1538:Fmo6 UTSW 1 162926106 missense probably damaging 1.00
R1694:Fmo6 UTSW 1 162922672 missense probably benign
R1717:Fmo6 UTSW 1 162926252 nonsense probably null
R1837:Fmo6 UTSW 1 162922810 missense probably benign
R2125:Fmo6 UTSW 1 162929958 missense possibly damaging 0.82
R2434:Fmo6 UTSW 1 162916870 missense probably benign 0.00
R4864:Fmo6 UTSW 1 162924395 missense probably benign 0.34
R6414:Fmo6 UTSW 1 162920445 missense probably damaging 0.97
R6576:Fmo6 UTSW 1 162922695 missense probably damaging 1.00
R6883:Fmo6 UTSW 1 162929892 missense probably damaging 1.00
R7013:Fmo6 UTSW 1 162918248 missense probably benign 0.00
R7014:Fmo6 UTSW 1 162926308 missense probably benign 0.13
R7657:Fmo6 UTSW 1 162922716 missense probably benign
X0025:Fmo6 UTSW 1 162920496 missense probably benign 0.29
X0025:Fmo6 UTSW 1 162922858 missense probably damaging 1.00
Z1176:Fmo6 UTSW 1 162926132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAGCCTGCACATGATCTG -3'
(R):5'- CAGAAGAATGCTGAGATCTGTATTGTC -3'

Sequencing Primer
(F):5'- GGACTCTGTCACCTGAGAAATTC -3'
(R):5'- ATGCTGAGATCTGTATTGTCTCTCTC -3'
Posted On2015-01-23