Incidental Mutation 'R2894:Nadk'
ID 260691
Institutional Source Beutler Lab
Gene Symbol Nadk
Ensembl Gene ENSMUSG00000029063
Gene Name NAD kinase
Synonyms 4432404C02Rik
MMRRC Submission 040482-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R2894 (G1)
Quality Score 223
Status Not validated
Chromosome 4
Chromosomal Location 155646838-155675458 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155671817 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 232 (N232S)
Ref Sequence ENSEMBL: ENSMUSP00000101238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030939] [ENSMUST00000105612] [ENSMUST00000105613]
AlphaFold P58058
Predicted Effect possibly damaging
Transcript: ENSMUST00000030939
AA Change: N232S

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030939
Gene: ENSMUSG00000029063
AA Change: N232S

DomainStartEndE-ValueType
Pfam:NAD_kinase 106 406 2.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105612
AA Change: N156S

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101237
Gene: ENSMUSG00000029063
AA Change: N156S

DomainStartEndE-ValueType
Pfam:NAD_kinase 30 330 7.6e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105613
AA Change: N232S

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101238
Gene: ENSMUSG00000029063
AA Change: N232S

DomainStartEndE-ValueType
Pfam:NAD_kinase 106 406 1.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152297
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions (Lerner et al., 2001 [PubMed 11594753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Acox3 A G 5: 35,757,192 (GRCm39) I344V probably benign Het
Ank2 T C 3: 127,041,892 (GRCm39) probably null Het
Ccl4 C A 11: 83,554,329 (GRCm39) probably null Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Cdk5rap2 T C 4: 70,208,110 (GRCm39) K779E probably benign Het
Cenpu C A 8: 47,029,384 (GRCm39) N212K probably damaging Het
Dcun1d2 A T 8: 13,328,649 (GRCm39) I86N probably damaging Het
Dnah1 T A 14: 31,020,718 (GRCm39) E1217V possibly damaging Het
Dusp15 T C 2: 152,791,005 (GRCm39) I31V probably benign Het
Ern2 A C 7: 121,780,810 (GRCm39) S114A possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fmo6 C T 1: 162,750,293 (GRCm39) W254* probably null Het
Gm16494 T C 17: 47,327,632 (GRCm39) E84G unknown Het
Kdr A G 5: 76,107,496 (GRCm39) F1016L probably damaging Het
Lrrc37a G A 11: 103,388,690 (GRCm39) T2245I unknown Het
Mdga1 T C 17: 30,071,478 (GRCm39) Y381C probably damaging Het
Msh3 G T 13: 92,478,868 (GRCm39) A367D probably benign Het
Or51e1 A G 7: 102,358,882 (GRCm39) T139A probably damaging Het
Or7g29 A T 9: 19,286,588 (GRCm39) Y196* probably null Het
Per2 C A 1: 91,373,325 (GRCm39) Q154H probably damaging Het
Pik3ap1 G A 19: 41,364,500 (GRCm39) A73V probably benign Het
Pramel16 A T 4: 143,675,692 (GRCm39) M378K probably damaging Het
Rad18 G A 6: 112,652,734 (GRCm39) Q288* probably null Het
Rarb T C 14: 16,435,146 (GRCm38) D300G probably damaging Het
Ruvbl1 C T 6: 88,456,114 (GRCm39) R63W possibly damaging Het
Setdb2 T C 14: 59,663,916 (GRCm39) N77S probably benign Het
Slc22a19 C A 19: 7,670,169 (GRCm39) K228N probably benign Het
Thoc6 A G 17: 23,888,009 (GRCm39) S292P probably damaging Het
Tmem126b A T 7: 90,120,121 (GRCm39) S83R probably damaging Het
Tmem232 C T 17: 65,757,408 (GRCm39) E262K probably damaging Het
Vmn2r60 T C 7: 41,785,220 (GRCm39) V144A probably benign Het
Vpreb3 C T 10: 75,779,056 (GRCm39) probably benign Het
Vwa8 A G 14: 79,275,578 (GRCm39) N787S probably damaging Het
Other mutations in Nadk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Nadk APN 4 155,673,157 (GRCm39) splice site probably benign
IGL02078:Nadk APN 4 155,663,860 (GRCm39) unclassified probably benign
IGL02116:Nadk APN 4 155,663,763 (GRCm39) splice site probably benign
IGL02951:Nadk APN 4 155,671,933 (GRCm39) missense probably benign 0.00
IGL03059:Nadk APN 4 155,671,253 (GRCm39) missense probably benign 0.02
IGL03203:Nadk APN 4 155,669,708 (GRCm39) missense probably damaging 0.99
R0416:Nadk UTSW 4 155,672,256 (GRCm39) splice site probably benign
R1633:Nadk UTSW 4 155,661,642 (GRCm39) missense probably damaging 1.00
R2044:Nadk UTSW 4 155,669,898 (GRCm39) missense probably damaging 1.00
R2891:Nadk UTSW 4 155,671,817 (GRCm39) missense possibly damaging 0.46
R2892:Nadk UTSW 4 155,671,817 (GRCm39) missense possibly damaging 0.46
R4275:Nadk UTSW 4 155,668,712 (GRCm39) missense probably benign 0.44
R4386:Nadk UTSW 4 155,667,032 (GRCm39) unclassified probably benign
R4416:Nadk UTSW 4 155,672,183 (GRCm39) nonsense probably null
R4703:Nadk UTSW 4 155,669,684 (GRCm39) missense probably benign 0.00
R4704:Nadk UTSW 4 155,669,684 (GRCm39) missense probably benign 0.00
R4705:Nadk UTSW 4 155,669,684 (GRCm39) missense probably benign 0.00
R5219:Nadk UTSW 4 155,668,711 (GRCm39) missense probably benign 0.00
R5610:Nadk UTSW 4 155,668,628 (GRCm39) missense probably damaging 1.00
R5673:Nadk UTSW 4 155,669,642 (GRCm39) missense possibly damaging 0.48
R6393:Nadk UTSW 4 155,673,808 (GRCm39) missense possibly damaging 0.60
R7091:Nadk UTSW 4 155,672,215 (GRCm39) missense probably benign 0.00
R7144:Nadk UTSW 4 155,673,793 (GRCm39) missense probably damaging 0.99
R7811:Nadk UTSW 4 155,661,332 (GRCm39) intron probably benign
R7951:Nadk UTSW 4 155,661,524 (GRCm39) missense probably benign 0.06
R7952:Nadk UTSW 4 155,661,524 (GRCm39) missense probably benign 0.06
R8002:Nadk UTSW 4 155,661,655 (GRCm39) critical splice donor site probably null
R8039:Nadk UTSW 4 155,661,524 (GRCm39) missense probably benign 0.06
R8041:Nadk UTSW 4 155,661,524 (GRCm39) missense probably benign 0.06
R8042:Nadk UTSW 4 155,661,524 (GRCm39) missense probably benign 0.06
R8066:Nadk UTSW 4 155,661,524 (GRCm39) missense probably benign 0.06
R8113:Nadk UTSW 4 155,655,127 (GRCm39) splice site probably null
R8558:Nadk UTSW 4 155,669,844 (GRCm39) missense probably benign 0.40
R9122:Nadk UTSW 4 155,671,275 (GRCm39) missense probably benign 0.00
Z1177:Nadk UTSW 4 155,672,157 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATCTCCCCTAACAGCTC -3'
(R):5'- TGAAGTTAGGCAGCTTGGGAAC -3'

Sequencing Primer
(F):5'- GGTCTTCTTTAAAAGCAGGCAGC -3'
(R):5'- GAACTTTCCACAGACCTGGTATTG -3'
Posted On 2015-01-23