Incidental Mutation 'R2894:Olfr558'
ID260701
Institutional Source Beutler Lab
Gene Symbol Olfr558
Ensembl Gene ENSMUSG00000070423
Gene Nameolfactory receptor 558
SynonymsMOR18-1, GA_x6K02T2PBJ9-5425951-5426904
MMRRC Submission 040482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2894 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102702215-102712064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102709675 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000091674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084817] [ENSMUST00000094124] [ENSMUST00000216312]
Predicted Effect probably benign
Transcript: ENSMUST00000084817
SMART Domains Protein: ENSMUSP00000081877
Gene: ENSMUSG00000066273

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 2.1e-117 PFAM
Pfam:7TM_GPCR_Srsx 41 211 7.5e-11 PFAM
Pfam:7tm_1 47 299 2.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094124
AA Change: T139A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091674
Gene: ENSMUSG00000070423
AA Change: T139A

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 6.2e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 2.4e-7 PFAM
Pfam:7tm_1 43 293 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210002
Predicted Effect probably benign
Transcript: ENSMUST00000216312
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Ccl4 C A 11: 83,663,503 probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Cenpu C A 8: 46,576,349 N212K probably damaging Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Dnah1 T A 14: 31,298,761 E1217V possibly damaging Het
Dusp15 T C 2: 152,949,085 I31V probably benign Het
Ern2 A C 7: 122,181,587 S114A possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fmo6 C T 1: 162,922,724 W254* probably null Het
Gm16494 T C 17: 47,016,706 E84G unknown Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Mdga1 T C 17: 29,852,504 Y381C probably damaging Het
Msh3 G T 13: 92,342,360 A367D probably benign Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr847 A T 9: 19,375,292 Y196* probably null Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Pramef25 A T 4: 143,949,122 M378K probably damaging Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rarb T C 14: 16,435,146 D300G probably damaging Het
Ruvbl1 C T 6: 88,479,132 R63W possibly damaging Het
Setdb2 T C 14: 59,426,467 N77S probably benign Het
Slc22a19 C A 19: 7,692,804 K228N probably benign Het
Thoc6 A G 17: 23,669,035 S292P probably damaging Het
Tmem126b A T 7: 90,470,913 S83R probably damaging Het
Tmem232 C T 17: 65,450,413 E262K probably damaging Het
Vmn2r60 T C 7: 42,135,796 V144A probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwa8 A G 14: 79,038,138 N787S probably damaging Het
Other mutations in Olfr558
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Olfr558 APN 7 102709565 missense probably damaging 0.99
IGL01925:Olfr558 APN 7 102710203 missense probably damaging 0.98
IGL02172:Olfr558 APN 7 102709844 missense probably benign
R0197:Olfr558 UTSW 7 102709995 missense probably damaging 1.00
R0883:Olfr558 UTSW 7 102709995 missense probably damaging 1.00
R1870:Olfr558 UTSW 7 102709754 missense possibly damaging 0.92
R4033:Olfr558 UTSW 7 102709490 missense probably damaging 1.00
R4695:Olfr558 UTSW 7 102709557 missense probably damaging 1.00
R4738:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4739:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4740:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4901:Olfr558 UTSW 7 102710198 missense probably benign 0.00
R5187:Olfr558 UTSW 7 102709661 missense probably damaging 1.00
R5385:Olfr558 UTSW 7 102709346 missense probably damaging 1.00
R5529:Olfr558 UTSW 7 102709693 nonsense probably null
R6666:Olfr558 UTSW 7 102709928 splice site probably null
R7318:Olfr558 UTSW 7 102710019 nonsense probably null
R7453:Olfr558 UTSW 7 102709517 missense probably damaging 0.99
R7546:Olfr558 UTSW 7 102709789 missense probably damaging 1.00
R7643:Olfr558 UTSW 7 102709538 missense probably benign 0.00
R8387:Olfr558 UTSW 7 102710195 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTTCTGGCCTAGACATCC -3'
(R):5'- AACCAATGGCTGAGATGATGAC -3'

Sequencing Primer
(F):5'- TCATCCATGCCAAAAATGATGG -3'
(R):5'- GAGTCCATAAATGATATTGACACGG -3'
Posted On2015-01-23