Mutagenetix > Incidental Mutations

Incidental Mutation 'R2894:Ern2'

260702

Institutional Source

Beutler Lab

Gene Symbol

Ern2

Ensembl Gene

ENSMUSG00000030866

Gene Name

endoplasmic reticulum (ER) to nucleus signalling 2

Synonyms

Ire1b

MMRRC Submission

040482-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R2894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122169893-122186207 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 122181587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 114 (S114A)

Ref Sequence

ENSEMBL: ENSMUSP00000145716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000206198]

AlphaFold

Q9Z2E3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033153
AA Change: S114A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: S114A

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
PQQ	33	64	5.5e-8	SMART
PQQ	115	147	4.7e-4	SMART
PQQ	148	180	6.1e-2	SMART
PQQ	192	223	6.2e-3	SMART
low complexity region	449	461	N/A	INTRINSIC
S_TKc	508	768	2.5e-11	SMART
PUG	831	888	9e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206198
AA Change: S114A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Acox3	A	G	5: 35,599,848	I344V	probably benign	Het
Ank2	T	C	3: 127,248,243		probably null	Het
Ccl4	C	A	11: 83,663,503		probably null	Het
Cdh15	G	A	8: 122,856,635	R59H	probably benign	Het
Cdk5rap2	T	C	4: 70,289,873	K779E	probably benign	Het
Cenpu	C	A	8: 46,576,349	N212K	probably damaging	Het
Dcun1d2	A	T	8: 13,278,649	I86N	probably damaging	Het
Dnah1	T	A	14: 31,298,761	E1217V	possibly damaging	Het
Dusp15	T	C	2: 152,949,085	I31V	probably benign	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Fmo6	C	T	1: 162,922,724	W254*	probably null	Het
Gm16494	T	C	17: 47,016,706	E84G	unknown	Het
Kdr	A	G	5: 75,946,836	F1016L	probably damaging	Het
Lrrc37a	G	A	11: 103,497,864	T2245I	unknown	Het
Mdga1	T	C	17: 29,852,504	Y381C	probably damaging	Het
Msh3	G	T	13: 92,342,360	A367D	probably benign	Het
Nadk	A	G	4: 155,587,360	N232S	possibly damaging	Het
Olfr558	A	G	7: 102,709,675	T139A	probably damaging	Het
Olfr847	A	T	9: 19,375,292	Y196*	probably null	Het
Per2	C	A	1: 91,445,603	Q154H	probably damaging	Het
Pik3ap1	G	A	19: 41,376,061	A73V	probably benign	Het
Pramef25	A	T	4: 143,949,122	M378K	probably damaging	Het
Rad18	G	A	6: 112,675,773	Q288*	probably null	Het
Rarb	T	C	14: 16,435,146	D300G	probably damaging	Het
Ruvbl1	C	T	6: 88,479,132	R63W	possibly damaging	Het
Setdb2	T	C	14: 59,426,467	N77S	probably benign	Het
Slc22a19	C	A	19: 7,692,804	K228N	probably benign	Het
Thoc6	A	G	17: 23,669,035	S292P	probably damaging	Het
Tmem126b	A	T	7: 90,470,913	S83R	probably damaging	Het
Tmem232	C	T	17: 65,450,413	E262K	probably damaging	Het
Vmn2r60	T	C	7: 42,135,796	V144A	probably benign	Het
Vpreb3	C	T	10: 75,943,222		probably benign	Het
Vwa8	A	G	14: 79,038,138	N787S	probably damaging	Het

Other mutations in Ern2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ern2	APN	7	122170092	missense	probably damaging	0.99
IGL01324:Ern2	APN	7	122183190	missense	possibly damaging	0.88
IGL02185:Ern2	APN	7	122173375	splice site	probably benign
IGL02738:Ern2	APN	7	122182899	missense	probably damaging	0.99
IGL02750:Ern2	APN	7	122181406	splice site	probably benign
IGL03247:Ern2	APN	7	122171671	missense	probably benign	0.02
ernie	UTSW	7	122171661	critical splice donor site	probably null
Ernie2	UTSW	7	122180862	splice site	probably benign
ernie3	UTSW	7	122173819	critical splice acceptor site	probably null
R0165:Ern2	UTSW	7	122179779	missense	probably benign	0.02
R0785:Ern2	UTSW	7	122171661	critical splice donor site	probably null
R0801:Ern2	UTSW	7	122180862	splice site	probably benign
R1345:Ern2	UTSW	7	122177770	missense	probably damaging	1.00
R1649:Ern2	UTSW	7	122177400	missense	probably damaging	1.00
R1747:Ern2	UTSW	7	122173819	critical splice acceptor site	probably null
R1747:Ern2	UTSW	7	122173820	critical splice acceptor site	probably null
R1846:Ern2	UTSW	7	122176536	missense	probably benign	0.32
R1899:Ern2	UTSW	7	122183842	splice site	probably benign
R1986:Ern2	UTSW	7	122171529	missense	probably benign	0.06
R2055:Ern2	UTSW	7	122183945	missense	possibly damaging	0.84
R2329:Ern2	UTSW	7	122173487	missense	possibly damaging	0.82
R2351:Ern2	UTSW	7	122171508	missense	probably damaging	0.97
R3176:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3276:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3945:Ern2	UTSW	7	122176530	missense	probably benign	0.10
R4303:Ern2	UTSW	7	122177846	critical splice acceptor site	probably null
R4874:Ern2	UTSW	7	122176587	missense	probably benign	0.28
R4943:Ern2	UTSW	7	122173258	missense	possibly damaging	0.95
R5184:Ern2	UTSW	7	122179959	missense	probably benign	0.03
R5629:Ern2	UTSW	7	122170166	missense	probably damaging	1.00
R5770:Ern2	UTSW	7	122179907	missense	possibly damaging	0.92
R6255:Ern2	UTSW	7	122173272	missense	probably damaging	1.00
R6272:Ern2	UTSW	7	122176646	missense	probably benign	0.05
R6277:Ern2	UTSW	7	122186107	missense	probably benign
R6624:Ern2	UTSW	7	122177783	missense	probably benign	0.00
R6940:Ern2	UTSW	7	122186146	missense	probably benign	0.01
R7491:Ern2	UTSW	7	122170533	missense	probably damaging	1.00
R7544:Ern2	UTSW	7	122173199	missense	probably benign	0.06
R7555:Ern2	UTSW	7	122170241	missense	probably damaging	1.00
R7843:Ern2	UTSW	7	122173708	missense	probably damaging	1.00
R8281:Ern2	UTSW	7	122170260	missense	probably damaging	1.00
R8321:Ern2	UTSW	7	122173208	missense	probably damaging	1.00
R8377:Ern2	UTSW	7	122181292	nonsense	probably null
R8548:Ern2	UTSW	7	122177839	missense	probably damaging	1.00
R8853:Ern2	UTSW	7	122173744	missense	probably damaging	1.00
R8929:Ern2	UTSW	7	122170140	missense	probably benign	0.03
R8931:Ern2	UTSW	7	122170140	missense	probably benign	0.03
R9088:Ern2	UTSW	7	122173667	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACTCAGGGTCCACTACAAAC -3'
(R):5'- ATGAGCTGACCTCCTTGTCC -3'

Sequencing Primer
(F):5'- CAGGCATCCTGCTTCCG -3'
(R):5'- CCTTGTCCTTTCTGAGCTACAG -3'

Posted On

2015-01-23