Mutagenetix > Incidental Mutation

Incidental Mutation 'R2894:Cdh15'

260707

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

040482-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 122856635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 59 (R59H)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

probably benign
Transcript: ENSMUST00000034443
AA Change: R59H

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: R59H

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.0984

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Acox3	A	G	5: 35,599,848	I344V	probably benign	Het
Ank2	T	C	3: 127,248,243		probably null	Het
Ccl4	C	A	11: 83,663,503		probably null	Het
Cdk5rap2	T	C	4: 70,289,873	K779E	probably benign	Het
Cenpu	C	A	8: 46,576,349	N212K	probably damaging	Het
Dcun1d2	A	T	8: 13,278,649	I86N	probably damaging	Het
Dnah1	T	A	14: 31,298,761	E1217V	possibly damaging	Het
Dusp15	T	C	2: 152,949,085	I31V	probably benign	Het
Ern2	A	C	7: 122,181,587	S114A	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Fmo6	C	T	1: 162,922,724	W254*	probably null	Het
Gm16494	T	C	17: 47,016,706	E84G	unknown	Het
Kdr	A	G	5: 75,946,836	F1016L	probably damaging	Het
Lrrc37a	G	A	11: 103,497,864	T2245I	unknown	Het
Mdga1	T	C	17: 29,852,504	Y381C	probably damaging	Het
Msh3	G	T	13: 92,342,360	A367D	probably benign	Het
Nadk	A	G	4: 155,587,360	N232S	possibly damaging	Het
Olfr558	A	G	7: 102,709,675	T139A	probably damaging	Het
Olfr847	A	T	9: 19,375,292	Y196*	probably null	Het
Per2	C	A	1: 91,445,603	Q154H	probably damaging	Het
Pik3ap1	G	A	19: 41,376,061	A73V	probably benign	Het
Pramef25	A	T	4: 143,949,122	M378K	probably damaging	Het
Rad18	G	A	6: 112,675,773	Q288*	probably null	Het
Rarb	T	C	14: 16,435,146	D300G	probably damaging	Het
Ruvbl1	C	T	6: 88,479,132	R63W	possibly damaging	Het
Setdb2	T	C	14: 59,426,467	N77S	probably benign	Het
Slc22a19	C	A	19: 7,692,804	K228N	probably benign	Het
Thoc6	A	G	17: 23,669,035	S292P	probably damaging	Het
Tmem126b	A	T	7: 90,470,913	S83R	probably damaging	Het
Tmem232	C	T	17: 65,450,413	E262K	probably damaging	Het
Vmn2r60	T	C	7: 42,135,796	V144A	probably benign	Het
Vpreb3	C	T	10: 75,943,222		probably benign	Het
Vwa8	A	G	14: 79,038,138	N787S	probably damaging	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1317:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	122864348	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	122856587	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	122866835	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	122857366	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	122860889	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	122848501	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	122857517	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	122859290	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	122862030	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	122864285	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	122864259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCCCTGTGTGATGACATTC -3'
(R):5'- GGGCTTCCCTATATCCAAGAGG -3'

Sequencing Primer
(F):5'- CCCTGTGTGATGACATTCTATTTG -3'
(R):5'- GAAGTCTTGAGTTCAATTCCCAGCG -3'

Posted On

2015-01-23