Incidental Mutation 'R2894:Olfr847'
ID 260708
Institutional Source Beutler Lab
Gene Symbol Olfr847
Ensembl Gene ENSMUSG00000059821
Gene Name olfactory receptor 847
Synonyms MOR149-2, GA_x6K02T2PVTD-13113073-13112135
MMRRC Submission 040482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R2894 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 19373668-19378669 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 19375292 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 196 (Y196*)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
AlphaFold Q8VFF4
Predicted Effect probably null
Transcript: ENSMUST00000079620
AA Change: Y196*
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: Y196*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212306
AA Change: Y196*
Predicted Effect probably null
Transcript: ENSMUST00000216839
AA Change: Y196*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Ccl4 C A 11: 83,663,503 probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Cenpu C A 8: 46,576,349 N212K probably damaging Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Dnah1 T A 14: 31,298,761 E1217V possibly damaging Het
Dusp15 T C 2: 152,949,085 I31V probably benign Het
Ern2 A C 7: 122,181,587 S114A possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fmo6 C T 1: 162,922,724 W254* probably null Het
Gm16494 T C 17: 47,016,706 E84G unknown Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Mdga1 T C 17: 29,852,504 Y381C probably damaging Het
Msh3 G T 13: 92,342,360 A367D probably benign Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr558 A G 7: 102,709,675 T139A probably damaging Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Pramef25 A T 4: 143,949,122 M378K probably damaging Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rarb T C 14: 16,435,146 D300G probably damaging Het
Ruvbl1 C T 6: 88,479,132 R63W possibly damaging Het
Setdb2 T C 14: 59,426,467 N77S probably benign Het
Slc22a19 C A 19: 7,692,804 K228N probably benign Het
Thoc6 A G 17: 23,669,035 S292P probably damaging Het
Tmem126b A T 7: 90,470,913 S83R probably damaging Het
Tmem232 C T 17: 65,450,413 E262K probably damaging Het
Vmn2r60 T C 7: 42,135,796 V144A probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwa8 A G 14: 79,038,138 N787S probably damaging Het
Other mutations in Olfr847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Olfr847 APN 9 19375239 missense probably damaging 1.00
IGL01293:Olfr847 APN 9 19375336 missense probably benign 0.23
IGL01879:Olfr847 APN 9 19375407 nonsense probably null
IGL03298:Olfr847 APN 9 19375062 missense probably damaging 1.00
R1350:Olfr847 UTSW 9 19375414 missense possibly damaging 0.94
R1400:Olfr847 UTSW 9 19375062 missense probably damaging 0.98
R4468:Olfr847 UTSW 9 19375648 missense probably benign 0.00
R4694:Olfr847 UTSW 9 19375398 missense probably damaging 1.00
R4791:Olfr847 UTSW 9 19375809 missense probably benign 0.28
R4794:Olfr847 UTSW 9 19375545 missense probably benign 0.00
R5517:Olfr847 UTSW 9 19375767 missense probably damaging 1.00
R5599:Olfr847 UTSW 9 19375629 missense possibly damaging 0.77
R5777:Olfr847 UTSW 9 19375718 missense probably benign 0.29
R6505:Olfr847 UTSW 9 19374941 makesense probably null
R6509:Olfr847 UTSW 9 19375143 missense probably benign
R7246:Olfr847 UTSW 9 19375465 nonsense probably null
R7659:Olfr847 UTSW 9 19375558 missense probably benign 0.03
R7789:Olfr847 UTSW 9 19375065 missense probably benign 0.33
R7886:Olfr847 UTSW 9 19375906 splice site probably null
R8948:Olfr847 UTSW 9 19374966 missense probably benign 0.03
R9326:Olfr847 UTSW 9 19375050 missense probably damaging 1.00
Z1088:Olfr847 UTSW 9 19375684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATACTCCCACTGCTGCAC -3'
(R):5'- TTTGTCATCCCCTGAATTACACAG -3'

Sequencing Primer
(F):5'- TGCTGCACCATAGAATAAGGATAC -3'
(R):5'- ATGAATCCCCAATTCTGTGGTTTG -3'
Posted On 2015-01-23