Incidental Mutation 'R2894:Vwa8'
ID 260718
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Name von Willebrand factor A domain containing 8
Synonyms 1300010F03Rik, 4932416F07Rik
MMRRC Submission 040482-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2894 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 79086492-79439750 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79275578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 787 (N787S)
Ref Sequence ENSEMBL: ENSMUSP00000154270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990] [ENSMUST00000227255]
AlphaFold Q8CC88
Predicted Effect probably damaging
Transcript: ENSMUST00000040990
AA Change: N787S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: N787S

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227255
AA Change: N787S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Acox3 A G 5: 35,757,192 (GRCm39) I344V probably benign Het
Ank2 T C 3: 127,041,892 (GRCm39) probably null Het
Ccl4 C A 11: 83,554,329 (GRCm39) probably null Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Cdk5rap2 T C 4: 70,208,110 (GRCm39) K779E probably benign Het
Cenpu C A 8: 47,029,384 (GRCm39) N212K probably damaging Het
Dcun1d2 A T 8: 13,328,649 (GRCm39) I86N probably damaging Het
Dnah1 T A 14: 31,020,718 (GRCm39) E1217V possibly damaging Het
Dusp15 T C 2: 152,791,005 (GRCm39) I31V probably benign Het
Ern2 A C 7: 121,780,810 (GRCm39) S114A possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fmo6 C T 1: 162,750,293 (GRCm39) W254* probably null Het
Gm16494 T C 17: 47,327,632 (GRCm39) E84G unknown Het
Kdr A G 5: 76,107,496 (GRCm39) F1016L probably damaging Het
Lrrc37a G A 11: 103,388,690 (GRCm39) T2245I unknown Het
Mdga1 T C 17: 30,071,478 (GRCm39) Y381C probably damaging Het
Msh3 G T 13: 92,478,868 (GRCm39) A367D probably benign Het
Nadk A G 4: 155,671,817 (GRCm39) N232S possibly damaging Het
Or51e1 A G 7: 102,358,882 (GRCm39) T139A probably damaging Het
Or7g29 A T 9: 19,286,588 (GRCm39) Y196* probably null Het
Per2 C A 1: 91,373,325 (GRCm39) Q154H probably damaging Het
Pik3ap1 G A 19: 41,364,500 (GRCm39) A73V probably benign Het
Pramel16 A T 4: 143,675,692 (GRCm39) M378K probably damaging Het
Rad18 G A 6: 112,652,734 (GRCm39) Q288* probably null Het
Rarb T C 14: 16,435,146 (GRCm38) D300G probably damaging Het
Ruvbl1 C T 6: 88,456,114 (GRCm39) R63W possibly damaging Het
Setdb2 T C 14: 59,663,916 (GRCm39) N77S probably benign Het
Slc22a19 C A 19: 7,670,169 (GRCm39) K228N probably benign Het
Thoc6 A G 17: 23,888,009 (GRCm39) S292P probably damaging Het
Tmem126b A T 7: 90,120,121 (GRCm39) S83R probably damaging Het
Tmem232 C T 17: 65,757,408 (GRCm39) E262K probably damaging Het
Vmn2r60 T C 7: 41,785,220 (GRCm39) V144A probably benign Het
Vpreb3 C T 10: 75,779,056 (GRCm39) probably benign Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79,275,635 (GRCm39) missense probably damaging 1.00
IGL01087:Vwa8 APN 14 79,172,669 (GRCm39) missense probably benign 0.16
IGL01137:Vwa8 APN 14 79,341,087 (GRCm39) missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79,302,353 (GRCm39) nonsense probably null
IGL01449:Vwa8 APN 14 79,420,428 (GRCm39) nonsense probably null
IGL01604:Vwa8 APN 14 79,418,244 (GRCm39) missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79,435,794 (GRCm39) missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79,435,717 (GRCm39) missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79,331,724 (GRCm39) missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 79,221,649 (GRCm39) missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 79,086,733 (GRCm39) missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 79,184,713 (GRCm39) critical splice donor site probably null
IGL02393:Vwa8 APN 14 79,420,417 (GRCm39) missense probably damaging 1.00
IGL02430:Vwa8 APN 14 79,172,085 (GRCm39) critical splice donor site probably null
IGL02476:Vwa8 APN 14 79,162,781 (GRCm39) missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79,420,552 (GRCm39) missense probably benign 0.01
IGL02678:Vwa8 APN 14 79,221,640 (GRCm39) missense probably damaging 0.99
IGL02797:Vwa8 APN 14 79,162,702 (GRCm39) missense probably benign 0.29
IGL02806:Vwa8 APN 14 79,394,528 (GRCm39) missense probably benign 0.35
IGL02811:Vwa8 APN 14 79,231,899 (GRCm39) missense probably benign 0.21
IGL02892:Vwa8 APN 14 79,341,140 (GRCm39) splice site probably benign
IGL03024:Vwa8 APN 14 79,232,538 (GRCm39) missense probably benign 0.03
IGL03075:Vwa8 APN 14 79,171,196 (GRCm39) missense probably damaging 0.99
IGL03090:Vwa8 APN 14 79,172,041 (GRCm39) missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79,296,255 (GRCm39) splice site probably benign
IGL03181:Vwa8 APN 14 79,246,690 (GRCm39) missense probably benign 0.01
IGL03296:Vwa8 APN 14 79,420,540 (GRCm39) missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79,420,574 (GRCm39) splice site probably null
R6812_Vwa8_870 UTSW 14 79,434,859 (GRCm39) missense probably damaging 0.99
IGL03052:Vwa8 UTSW 14 79,302,361 (GRCm39) missense probably benign 0.02
PIT4468001:Vwa8 UTSW 14 79,420,501 (GRCm39) missense probably damaging 1.00
R0049:Vwa8 UTSW 14 79,331,179 (GRCm39) missense probably benign 0.21
R0063:Vwa8 UTSW 14 79,401,656 (GRCm39) splice site probably benign
R0063:Vwa8 UTSW 14 79,401,656 (GRCm39) splice site probably benign
R0081:Vwa8 UTSW 14 79,320,222 (GRCm39) missense probably benign 0.02
R0305:Vwa8 UTSW 14 79,246,713 (GRCm39) missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79,300,116 (GRCm39) missense probably damaging 1.00
R0514:Vwa8 UTSW 14 79,184,629 (GRCm39) missense probably benign
R0602:Vwa8 UTSW 14 79,258,060 (GRCm39) missense probably benign 0.00
R0615:Vwa8 UTSW 14 79,145,590 (GRCm39) missense probably benign
R0791:Vwa8 UTSW 14 79,232,016 (GRCm39) splice site probably benign
R1028:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79,324,094 (GRCm39) nonsense probably null
R1404:Vwa8 UTSW 14 79,263,471 (GRCm39) missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79,263,471 (GRCm39) missense probably damaging 1.00
R1412:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1421:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79,341,134 (GRCm39) nonsense probably null
R1467:Vwa8 UTSW 14 79,341,134 (GRCm39) nonsense probably null
R1539:Vwa8 UTSW 14 79,300,002 (GRCm39) missense probably benign 0.00
R1556:Vwa8 UTSW 14 79,324,121 (GRCm39) missense probably benign
R1589:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1590:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1591:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79,420,427 (GRCm39) missense probably damaging 1.00
R1673:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79,438,543 (GRCm39) missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 79,145,635 (GRCm39) missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79,318,576 (GRCm39) missense probably benign 0.04
R1926:Vwa8 UTSW 14 79,258,075 (GRCm39) missense probably benign 0.00
R1959:Vwa8 UTSW 14 79,219,800 (GRCm39) missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 79,162,694 (GRCm39) splice site probably benign
R2078:Vwa8 UTSW 14 79,145,597 (GRCm39) missense probably damaging 1.00
R2103:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79,329,843 (GRCm39) critical splice donor site probably null
R2281:Vwa8 UTSW 14 79,302,436 (GRCm39) missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 79,149,658 (GRCm39) missense probably damaging 0.98
R2847:Vwa8 UTSW 14 79,184,582 (GRCm39) missense probably benign 0.00
R2848:Vwa8 UTSW 14 79,184,582 (GRCm39) missense probably benign 0.00
R2991:Vwa8 UTSW 14 79,232,589 (GRCm39) missense probably benign 0.00
R3077:Vwa8 UTSW 14 79,335,782 (GRCm39) missense probably benign 0.03
R3405:Vwa8 UTSW 14 79,401,660 (GRCm39) splice site probably benign
R3406:Vwa8 UTSW 14 79,401,660 (GRCm39) splice site probably benign
R3708:Vwa8 UTSW 14 79,300,136 (GRCm39) splice site probably benign
R3779:Vwa8 UTSW 14 79,339,762 (GRCm39) splice site probably benign
R3799:Vwa8 UTSW 14 79,302,336 (GRCm39) missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79,320,292 (GRCm39) missense probably benign 0.00
R4425:Vwa8 UTSW 14 79,320,246 (GRCm39) missense probably benign 0.00
R4478:Vwa8 UTSW 14 79,106,241 (GRCm39) missense probably benign 0.00
R4627:Vwa8 UTSW 14 79,341,137 (GRCm39) critical splice donor site probably null
R4835:Vwa8 UTSW 14 79,172,053 (GRCm39) missense probably benign 0.11
R4868:Vwa8 UTSW 14 79,420,522 (GRCm39) missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79,435,723 (GRCm39) missense probably benign 0.05
R5137:Vwa8 UTSW 14 79,302,342 (GRCm39) missense probably damaging 1.00
R5156:Vwa8 UTSW 14 79,221,666 (GRCm39) missense probably benign 0.00
R5658:Vwa8 UTSW 14 79,219,838 (GRCm39) critical splice donor site probably null
R5841:Vwa8 UTSW 14 79,231,958 (GRCm39) missense probably benign
R6057:Vwa8 UTSW 14 79,320,313 (GRCm39) missense probably benign 0.21
R6244:Vwa8 UTSW 14 79,324,102 (GRCm39) missense probably benign
R6264:Vwa8 UTSW 14 79,324,252 (GRCm39) missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79,331,772 (GRCm39) splice site probably null
R6332:Vwa8 UTSW 14 79,434,904 (GRCm39) missense probably benign
R6395:Vwa8 UTSW 14 79,331,184 (GRCm39) missense probably benign 0.02
R6472:Vwa8 UTSW 14 79,246,610 (GRCm39) missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79,333,841 (GRCm39) missense probably benign 0.00
R6527:Vwa8 UTSW 14 79,184,653 (GRCm39) missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79,435,662 (GRCm39) missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79,434,859 (GRCm39) missense probably damaging 0.99
R6994:Vwa8 UTSW 14 79,145,596 (GRCm39) missense possibly damaging 0.90
R7040:Vwa8 UTSW 14 79,149,645 (GRCm39) missense probably damaging 1.00
R7357:Vwa8 UTSW 14 79,275,641 (GRCm39) missense probably null 1.00
R7363:Vwa8 UTSW 14 79,256,147 (GRCm39) missense probably benign 0.05
R7381:Vwa8 UTSW 14 79,333,125 (GRCm39) missense probably benign 0.00
R7406:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7408:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7409:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7410:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7483:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7484:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7491:Vwa8 UTSW 14 79,320,254 (GRCm39) missense probably benign 0.24
R7500:Vwa8 UTSW 14 79,162,686 (GRCm39) splice site probably null
R7514:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7582:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7584:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7585:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7647:Vwa8 UTSW 14 79,172,669 (GRCm39) missense probably damaging 0.99
R7685:Vwa8 UTSW 14 79,335,740 (GRCm39) missense probably benign
R7703:Vwa8 UTSW 14 79,263,513 (GRCm39) missense probably damaging 1.00
R7730:Vwa8 UTSW 14 79,232,589 (GRCm39) missense probably benign 0.00
R7775:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7778:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7824:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7885:Vwa8 UTSW 14 79,258,089 (GRCm39) missense probably benign 0.00
R7902:Vwa8 UTSW 14 79,329,731 (GRCm39) missense probably benign 0.00
R8262:Vwa8 UTSW 14 79,171,272 (GRCm39) critical splice donor site probably null
R8458:Vwa8 UTSW 14 79,302,332 (GRCm39) missense probably damaging 1.00
R8495:Vwa8 UTSW 14 79,174,617 (GRCm39) nonsense probably null
R8557:Vwa8 UTSW 14 79,246,649 (GRCm39) missense probably damaging 1.00
R8841:Vwa8 UTSW 14 79,184,702 (GRCm39) missense probably benign 0.04
R8906:Vwa8 UTSW 14 79,329,815 (GRCm39) missense probably benign 0.00
R8947:Vwa8 UTSW 14 79,438,552 (GRCm39) missense probably damaging 1.00
R9034:Vwa8 UTSW 14 79,296,179 (GRCm39) missense probably damaging 1.00
R9051:Vwa8 UTSW 14 79,324,150 (GRCm39) missense probably benign 0.00
R9179:Vwa8 UTSW 14 79,335,801 (GRCm39) missense probably benign
R9433:Vwa8 UTSW 14 79,335,871 (GRCm39) critical splice donor site probably null
R9455:Vwa8 UTSW 14 79,300,115 (GRCm39) missense probably damaging 1.00
R9496:Vwa8 UTSW 14 79,258,122 (GRCm39) missense probably benign
R9530:Vwa8 UTSW 14 79,172,639 (GRCm39) missense probably benign 0.33
R9584:Vwa8 UTSW 14 79,394,549 (GRCm39) missense probably benign
R9763:Vwa8 UTSW 14 79,186,988 (GRCm39) missense probably damaging 1.00
Z1088:Vwa8 UTSW 14 79,219,686 (GRCm39) missense probably benign 0.38
Z1177:Vwa8 UTSW 14 79,296,132 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGACTTCCTCTCATAAGAACAGC -3'
(R):5'- TGGGAAGGAAGCTGGCTTAT -3'

Sequencing Primer
(F):5'- TTCCTCTCATAAGAACAGCGTAGGG -3'
(R):5'- TATAAAGCAGGCTTTTAGGAGAGTC -3'
Posted On 2015-01-23