Incidental Mutation 'R2894:Mdga1'
ID 260722
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms Mamdc3, 1200011I03Rik
MMRRC Submission 040482-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R2894 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 30046930-30107557 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30071478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 381 (Y381C)
Ref Sequence ENSEMBL: ENSMUSP00000130395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000165211] [ENSMUST00000167190] [ENSMUST00000171691]
AlphaFold Q0PMG2
Predicted Effect probably damaging
Transcript: ENSMUST00000073556
AA Change: Y107C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: Y107C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165211
AA Change: Y107C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132583
Gene: ENSMUSG00000043557
AA Change: Y107C

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG_like 148 221 6.07e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167102
Predicted Effect probably damaging
Transcript: ENSMUST00000167190
AA Change: Y381C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557
AA Change: Y381C

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171691
AA Change: Y107C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: Y107C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Acox3 A G 5: 35,757,192 (GRCm39) I344V probably benign Het
Ank2 T C 3: 127,041,892 (GRCm39) probably null Het
Ccl4 C A 11: 83,554,329 (GRCm39) probably null Het
Cdh15 G A 8: 123,583,374 (GRCm39) R59H probably benign Het
Cdk5rap2 T C 4: 70,208,110 (GRCm39) K779E probably benign Het
Cenpu C A 8: 47,029,384 (GRCm39) N212K probably damaging Het
Dcun1d2 A T 8: 13,328,649 (GRCm39) I86N probably damaging Het
Dnah1 T A 14: 31,020,718 (GRCm39) E1217V possibly damaging Het
Dusp15 T C 2: 152,791,005 (GRCm39) I31V probably benign Het
Ern2 A C 7: 121,780,810 (GRCm39) S114A possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fmo6 C T 1: 162,750,293 (GRCm39) W254* probably null Het
Gm16494 T C 17: 47,327,632 (GRCm39) E84G unknown Het
Kdr A G 5: 76,107,496 (GRCm39) F1016L probably damaging Het
Lrrc37a G A 11: 103,388,690 (GRCm39) T2245I unknown Het
Msh3 G T 13: 92,478,868 (GRCm39) A367D probably benign Het
Nadk A G 4: 155,671,817 (GRCm39) N232S possibly damaging Het
Or51e1 A G 7: 102,358,882 (GRCm39) T139A probably damaging Het
Or7g29 A T 9: 19,286,588 (GRCm39) Y196* probably null Het
Per2 C A 1: 91,373,325 (GRCm39) Q154H probably damaging Het
Pik3ap1 G A 19: 41,364,500 (GRCm39) A73V probably benign Het
Pramel16 A T 4: 143,675,692 (GRCm39) M378K probably damaging Het
Rad18 G A 6: 112,652,734 (GRCm39) Q288* probably null Het
Rarb T C 14: 16,435,146 (GRCm38) D300G probably damaging Het
Ruvbl1 C T 6: 88,456,114 (GRCm39) R63W possibly damaging Het
Setdb2 T C 14: 59,663,916 (GRCm39) N77S probably benign Het
Slc22a19 C A 19: 7,670,169 (GRCm39) K228N probably benign Het
Thoc6 A G 17: 23,888,009 (GRCm39) S292P probably damaging Het
Tmem126b A T 7: 90,120,121 (GRCm39) S83R probably damaging Het
Tmem232 C T 17: 65,757,408 (GRCm39) E262K probably damaging Het
Vmn2r60 T C 7: 41,785,220 (GRCm39) V144A probably benign Het
Vpreb3 C T 10: 75,779,056 (GRCm39) probably benign Het
Vwa8 A G 14: 79,275,578 (GRCm39) N787S probably damaging Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 30,062,101 (GRCm39) missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 30,058,845 (GRCm39) missense probably damaging 1.00
IGL02130:Mdga1 APN 17 30,076,643 (GRCm39) missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 30,051,379 (GRCm39) splice site probably benign
IGL03258:Mdga1 APN 17 30,058,887 (GRCm39) missense probably damaging 1.00
R0184:Mdga1 UTSW 17 30,071,416 (GRCm39) missense probably damaging 1.00
R0366:Mdga1 UTSW 17 30,076,682 (GRCm39) missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 30,069,522 (GRCm39) missense probably damaging 0.98
R1520:Mdga1 UTSW 17 30,065,493 (GRCm39) missense probably benign 0.12
R1545:Mdga1 UTSW 17 30,061,876 (GRCm39) missense probably damaging 1.00
R1549:Mdga1 UTSW 17 30,056,972 (GRCm39) missense probably damaging 1.00
R1671:Mdga1 UTSW 17 30,069,603 (GRCm39) missense probably damaging 1.00
R1875:Mdga1 UTSW 17 30,071,581 (GRCm39) missense probably damaging 1.00
R1893:Mdga1 UTSW 17 30,068,200 (GRCm39) missense probably damaging 1.00
R1958:Mdga1 UTSW 17 30,059,862 (GRCm39) missense probably damaging 1.00
R1983:Mdga1 UTSW 17 30,069,579 (GRCm39) missense probably damaging 1.00
R2014:Mdga1 UTSW 17 30,068,287 (GRCm39) missense probably damaging 1.00
R2964:Mdga1 UTSW 17 30,071,442 (GRCm39) missense probably damaging 1.00
R3813:Mdga1 UTSW 17 30,057,453 (GRCm39) missense probably damaging 1.00
R3938:Mdga1 UTSW 17 30,076,596 (GRCm39) missense probably damaging 1.00
R3982:Mdga1 UTSW 17 30,150,238 (GRCm39) missense unknown
R4063:Mdga1 UTSW 17 30,057,005 (GRCm39) missense probably damaging 1.00
R4157:Mdga1 UTSW 17 30,052,317 (GRCm39) missense probably benign 0.32
R4183:Mdga1 UTSW 17 30,188,964 (GRCm39) missense unknown
R4392:Mdga1 UTSW 17 30,069,630 (GRCm39) missense probably damaging 1.00
R4393:Mdga1 UTSW 17 30,069,491 (GRCm39) missense probably damaging 1.00
R4396:Mdga1 UTSW 17 30,069,491 (GRCm39) missense probably damaging 1.00
R4806:Mdga1 UTSW 17 30,061,128 (GRCm39) missense probably benign 0.20
R4829:Mdga1 UTSW 17 30,065,343 (GRCm39) missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 30,057,052 (GRCm39) missense probably damaging 0.99
R4932:Mdga1 UTSW 17 30,076,580 (GRCm39) missense probably damaging 1.00
R5015:Mdga1 UTSW 17 30,058,847 (GRCm39) missense possibly damaging 0.71
R5076:Mdga1 UTSW 17 30,069,528 (GRCm39) missense possibly damaging 0.93
R5141:Mdga1 UTSW 17 30,071,467 (GRCm39) missense probably benign 0.43
R5180:Mdga1 UTSW 17 30,076,710 (GRCm39) splice site probably benign
R5590:Mdga1 UTSW 17 30,058,841 (GRCm39) missense probably damaging 1.00
R5747:Mdga1 UTSW 17 30,069,525 (GRCm39) missense probably benign 0.11
R5748:Mdga1 UTSW 17 30,069,525 (GRCm39) missense probably benign 0.11
R6207:Mdga1 UTSW 17 30,057,491 (GRCm39) missense probably damaging 1.00
R6826:Mdga1 UTSW 17 30,189,000 (GRCm39) missense unknown
R6831:Mdga1 UTSW 17 30,106,490 (GRCm39) nonsense probably null
R7114:Mdga1 UTSW 17 30,061,816 (GRCm39) splice site probably null
R7147:Mdga1 UTSW 17 30,065,495 (GRCm39) nonsense probably null
R7273:Mdga1 UTSW 17 30,188,912 (GRCm39) missense unknown
R7413:Mdga1 UTSW 17 30,069,647 (GRCm39) missense probably damaging 1.00
R7637:Mdga1 UTSW 17 30,051,353 (GRCm39) missense probably benign 0.00
R7797:Mdga1 UTSW 17 30,061,814 (GRCm39) splice site probably null
R7812:Mdga1 UTSW 17 30,062,115 (GRCm39) missense probably benign 0.02
R7838:Mdga1 UTSW 17 30,058,796 (GRCm39) missense probably benign 0.10
R8463:Mdga1 UTSW 17 30,068,703 (GRCm39) missense probably damaging 1.00
R8697:Mdga1 UTSW 17 30,065,615 (GRCm39) missense probably damaging 0.97
R8699:Mdga1 UTSW 17 30,061,348 (GRCm39) missense possibly damaging 0.87
R8864:Mdga1 UTSW 17 30,150,295 (GRCm39) missense unknown
R8945:Mdga1 UTSW 17 30,058,959 (GRCm39) splice site probably benign
R9150:Mdga1 UTSW 17 30,057,420 (GRCm39) missense probably damaging 0.98
R9157:Mdga1 UTSW 17 30,057,491 (GRCm39) missense probably damaging 1.00
R9294:Mdga1 UTSW 17 30,058,871 (GRCm39) missense probably damaging 1.00
R9301:Mdga1 UTSW 17 30,069,512 (GRCm39) missense probably benign 0.31
R9367:Mdga1 UTSW 17 30,051,282 (GRCm39) makesense probably null
R9567:Mdga1 UTSW 17 30,076,569 (GRCm39) missense probably damaging 1.00
R9665:Mdga1 UTSW 17 30,051,991 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGGTCTTTCCAGCCCTTC -3'
(R):5'- TCCTAAGGGTCATGAAGGTCAG -3'

Sequencing Primer
(F):5'- GAGGTCTTTCCAGCCCTTCACTAC -3'
(R):5'- TACCCTGGAGAGCATGGG -3'
Posted On 2015-01-23