Incidental Mutation 'R2894:Tmem232'
ID260724
Institutional Source Beutler Lab
Gene Symbol Tmem232
Ensembl Gene ENSMUSG00000045036
Gene Nametransmembrane protein 232
SynonymsLOC381107, E130009J12Rik
MMRRC Submission 040482-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2894 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location65256005-65540782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65450413 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 262 (E262K)
Ref Sequence ENSEMBL: ENSMUSP00000083927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062161] [ENSMUST00000086722]
Predicted Effect probably damaging
Transcript: ENSMUST00000062161
AA Change: E262K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055652
Gene: ENSMUSG00000045036
AA Change: E262K

DomainStartEndE-ValueType
Pfam:TMEM232 40 488 5.3e-235 PFAM
coiled coil region 598 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086722
AA Change: E262K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083927
Gene: ENSMUSG00000045036
AA Change: E262K

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
coiled coil region 598 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Acox3 A G 5: 35,599,848 I344V probably benign Het
Ank2 T C 3: 127,248,243 probably null Het
Ccl4 C A 11: 83,663,503 probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cdk5rap2 T C 4: 70,289,873 K779E probably benign Het
Cenpu C A 8: 46,576,349 N212K probably damaging Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Dnah1 T A 14: 31,298,761 E1217V possibly damaging Het
Dusp15 T C 2: 152,949,085 I31V probably benign Het
Ern2 A C 7: 122,181,587 S114A possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fmo6 C T 1: 162,922,724 W254* probably null Het
Gm16494 T C 17: 47,016,706 E84G unknown Het
Kdr A G 5: 75,946,836 F1016L probably damaging Het
Lrrc37a G A 11: 103,497,864 T2245I unknown Het
Mdga1 T C 17: 29,852,504 Y381C probably damaging Het
Msh3 G T 13: 92,342,360 A367D probably benign Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr558 A G 7: 102,709,675 T139A probably damaging Het
Olfr847 A T 9: 19,375,292 Y196* probably null Het
Per2 C A 1: 91,445,603 Q154H probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Pramef25 A T 4: 143,949,122 M378K probably damaging Het
Rad18 G A 6: 112,675,773 Q288* probably null Het
Rarb T C 14: 16,435,146 D300G probably damaging Het
Ruvbl1 C T 6: 88,479,132 R63W possibly damaging Het
Setdb2 T C 14: 59,426,467 N77S probably benign Het
Slc22a19 C A 19: 7,692,804 K228N probably benign Het
Thoc6 A G 17: 23,669,035 S292P probably damaging Het
Tmem126b A T 7: 90,470,913 S83R probably damaging Het
Vmn2r60 T C 7: 42,135,796 V144A probably benign Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Vwa8 A G 14: 79,038,138 N787S probably damaging Het
Other mutations in Tmem232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Tmem232 APN 17 65256574 missense possibly damaging 0.71
IGL00954:Tmem232 APN 17 65500153 missense probably damaging 1.00
IGL01530:Tmem232 APN 17 65256548 nonsense probably null
IGL02881:Tmem232 APN 17 65450370 missense probably damaging 1.00
IGL02969:Tmem232 APN 17 65256563 missense possibly damaging 0.69
IGL02972:Tmem232 APN 17 65476673 missense probably benign 0.00
IGL03028:Tmem232 APN 17 65256389 missense probably benign 0.14
IGL03293:Tmem232 APN 17 65450374 missense probably damaging 1.00
R0380:Tmem232 UTSW 17 65256448 missense probably benign 0.23
R0432:Tmem232 UTSW 17 65256503 missense probably damaging 0.99
R0524:Tmem232 UTSW 17 65485942 missense probably damaging 0.98
R0548:Tmem232 UTSW 17 65382620 missense probably benign 0.22
R1345:Tmem232 UTSW 17 65450406 missense possibly damaging 0.60
R1521:Tmem232 UTSW 17 65484501 missense probably damaging 0.99
R1954:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R1955:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R2012:Tmem232 UTSW 17 65500172 missense probably benign 0.21
R2294:Tmem232 UTSW 17 65450441 missense probably benign 0.00
R2369:Tmem232 UTSW 17 65402997 missense probably damaging 1.00
R2384:Tmem232 UTSW 17 65402857 missense probably damaging 1.00
R3431:Tmem232 UTSW 17 65265302 splice site probably null
R3788:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R3789:Tmem232 UTSW 17 65382525 missense probably benign 0.02
R3789:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R4155:Tmem232 UTSW 17 65436333 missense probably damaging 0.97
R4691:Tmem232 UTSW 17 65265242 missense possibly damaging 0.88
R4838:Tmem232 UTSW 17 65430888 missense probably benign 0.04
R5340:Tmem232 UTSW 17 65402998 missense possibly damaging 0.92
R5619:Tmem232 UTSW 17 65486511 missense probably benign 0.06
R6176:Tmem232 UTSW 17 65485872 missense probably damaging 1.00
R6192:Tmem232 UTSW 17 65430805 missense probably damaging 1.00
R6223:Tmem232 UTSW 17 65500196 start codon destroyed probably null 0.99
R6256:Tmem232 UTSW 17 65478402 missense possibly damaging 0.89
R6782:Tmem232 UTSW 17 65500124 missense possibly damaging 0.88
R6856:Tmem232 UTSW 17 65450310 missense possibly damaging 0.57
R7262:Tmem232 UTSW 17 65500117 missense probably benign
R7459:Tmem232 UTSW 17 65256389 missense probably benign 0.14
R7699:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R7700:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R8284:Tmem232 UTSW 17 65402995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCTCCTGGAGTCACTC -3'
(R):5'- ACATTGAACACAGGGACTTGTAAAC -3'

Sequencing Primer
(F):5'- CTCCTGGAGTCACTCTGGATTTATAG -3'
(R):5'- CACAGGGACTTGTAAACATTTTGTG -3'
Posted On2015-01-23