Incidental Mutation 'R2895:Gpr1'
ID260728
Institutional Source Beutler Lab
Gene Symbol Gpr1
Ensembl Gene ENSMUSG00000046856
Gene NameG protein-coupled receptor 1
Synonyms
MMRRC Submission 040483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2895 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63182691-63214543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63183162 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 305 (I305L)
Ref Sequence ENSEMBL: ENSMUSP00000051417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027108] [ENSMUST00000050536] [ENSMUST00000129339] [ENSMUST00000135877] [ENSMUST00000142062] [ENSMUST00000174890] [ENSMUST00000188524]
Predicted Effect probably benign
Transcript: ENSMUST00000027108
Predicted Effect probably benign
Transcript: ENSMUST00000050536
AA Change: I305L

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051417
Gene: ENSMUSG00000046856
AA Change: I305L

DomainStartEndE-ValueType
Pfam:7tm_1 55 302 3.9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126469
Predicted Effect probably benign
Transcript: ENSMUST00000126795
SMART Domains Protein: ENSMUSP00000134341
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
SCOP:d1aw9_1 4 62 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129339
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135877
SMART Domains Protein: ENSMUSP00000137671
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148553
Predicted Effect probably benign
Transcript: ENSMUST00000174890
SMART Domains Protein: ENSMUSP00000133545
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
Blast:WHEP 3 64 3e-6 BLAST
SCOP:d1aw9_1 7 65 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199062
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Asic1 A G 15: 99,696,602 I310V probably benign Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cd96 G T 16: 46,117,805 T99K probably benign Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Pot1b A T 17: 55,687,939 I241N probably damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rgsl1 T A 1: 153,827,548 E154V probably damaging Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Other mutations in Gpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Gpr1 APN 1 63183338 missense probably damaging 0.99
IGL01086:Gpr1 APN 1 63183491 missense probably benign 0.01
IGL01490:Gpr1 APN 1 63183296 missense probably damaging 0.99
IGL02409:Gpr1 APN 1 63183716 missense probably damaging 1.00
IGL02426:Gpr1 APN 1 63183668 missense probably damaging 0.97
R0218:Gpr1 UTSW 1 63183531 missense probably benign 0.25
R2088:Gpr1 UTSW 1 63183652 unclassified probably null
R2166:Gpr1 UTSW 1 63183948 missense probably benign
R2896:Gpr1 UTSW 1 63183162 missense probably benign 0.24
R5102:Gpr1 UTSW 1 63183167 missense probably damaging 0.99
R5131:Gpr1 UTSW 1 63183681 missense probably damaging 1.00
R5471:Gpr1 UTSW 1 63183899 missense probably damaging 1.00
R5652:Gpr1 UTSW 1 63183467 missense probably benign 0.00
R6187:Gpr1 UTSW 1 63183275 missense probably damaging 1.00
X0060:Gpr1 UTSW 1 63183059 missense probably benign 0.02
Z1177:Gpr1 UTSW 1 63183639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGGATCAGAATGCAACCTAATC -3'
(R):5'- ATCCTGTCTGTGGTCATTGC -3'

Sequencing Primer
(F):5'- GGCTCACATGAAAACTTTGCACTG -3'
(R):5'- GCCTTCTTGGTTTGCTGGACC -3'
Posted On2015-01-23