Incidental Mutation 'R2895:Rgsl1'
ID260733
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
MMRRC Submission 040483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2895 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153827548 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 154 (E154V)
Ref Sequence ENSEMBL: ENSMUSP00000139340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124558
AA Change: E119V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: E119V

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184095
Predicted Effect probably damaging
Transcript: ENSMUST00000185164
AA Change: E154V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: E154V

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Asic1 A G 15: 99,696,602 I310V probably benign Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cd96 G T 16: 46,117,805 T99K probably benign Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Pot1b A T 17: 55,687,939 I241N probably damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153802234 critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153825905 missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2229:Rgsl1 UTSW 1 153822358 missense possibly damaging 0.72
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153827448 missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153822371 missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153822317 missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R6974:Rgsl1 UTSW 1 153799822 missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153825479 missense probably benign
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- CAAAGGATGGGCGTTACCAG -3'
(R):5'- GGGACTTTCTGGAGATGCAATC -3'

Sequencing Primer
(F):5'- ATGGGCGTTACCAGCTACC -3'
(R):5'- CAATCTTAACTGGAAGTTGGCTAGCG -3'
Posted On2015-01-23