Incidental Mutation 'R2895:Abhd14b'
ID260750
Institutional Source Beutler Lab
Gene Symbol Abhd14b
Ensembl Gene ENSMUSG00000042073
Gene Nameabhydrolase domain containing 14b
Synonyms1810013B01Rik
MMRRC Submission 040483-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R2895 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106447459-106452923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106450114 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 32 (R32C)
Ref Sequence ENSEMBL: ENSMUSP00000150885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024260] [ENSMUST00000048527] [ENSMUST00000048685] [ENSMUST00000171678] [ENSMUST00000171925] [ENSMUST00000185334] [ENSMUST00000185347] [ENSMUST00000185527] [ENSMUST00000185779] [ENSMUST00000185874] [ENSMUST00000186361] [ENSMUST00000187001] [ENSMUST00000187106] [ENSMUST00000190167] [ENSMUST00000190798] [ENSMUST00000213179] [ENSMUST00000214252] [ENSMUST00000215475] [ENSMUST00000215656] [ENSMUST00000216130] [ENSMUST00000216379] [ENSMUST00000217496]
Predicted Effect probably benign
Transcript: ENSMUST00000024260
SMART Domains Protein: ENSMUSP00000024260
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 4.15e-14 SMART
KH 100 171 1.47e-14 SMART
KH 240 310 3.24e-16 SMART
low complexity region 327 349 N/A INTRINSIC
low complexity region 364 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048527
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000038755
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 189 7.9e-18 PFAM
Pfam:Abhydrolase_6 35 141 2.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048685
SMART Domains Protein: ENSMUSP00000047322
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171678
SMART Domains Protein: ENSMUSP00000126101
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171925
SMART Domains Protein: ENSMUSP00000126916
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Abhydrolase_5 73 245 7.9e-17 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185334
SMART Domains Protein: ENSMUSP00000140345
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185347
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140279
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 183 7.6e-15 PFAM
Pfam:Abhydrolase_6 35 145 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185527
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139760
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 174 3.3e-14 PFAM
Pfam:Abhydrolase_6 35 144 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185779
SMART Domains Protein: ENSMUSP00000140629
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
KH 100 171 9.3e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185854
Predicted Effect probably benign
Transcript: ENSMUST00000185874
SMART Domains Protein: ENSMUSP00000141057
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186361
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141151
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 189 1.5e-17 PFAM
Pfam:Abhydrolase_6 35 145 5.1e-15 PFAM
Pfam:Abhydrolase_6 141 194 1.5e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186713
Predicted Effect probably benign
Transcript: ENSMUST00000187001
SMART Domains Protein: ENSMUSP00000140042
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1imja_ 51 110 1e-10 SMART
PDB:1IMJ|A 58 110 6e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187106
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139597
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 142 2.5e-9 PFAM
Pfam:Abhydrolase_6 35 141 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187975
Predicted Effect probably benign
Transcript: ENSMUST00000190167
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140655
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 149 1.4e-9 PFAM
Pfam:Abhydrolase_6 35 147 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190798
SMART Domains Protein: ENSMUSP00000141096
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 1.7e-8 PFAM
Pfam:Abhydrolase_5 73 157 1.2e-8 PFAM
Pfam:Abhydrolase_6 74 157 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213179
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000214252
Predicted Effect probably benign
Transcript: ENSMUST00000215475
Predicted Effect probably benign
Transcript: ENSMUST00000215656
Predicted Effect probably benign
Transcript: ENSMUST00000216130
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000216379
Predicted Effect probably benign
Transcript: ENSMUST00000217496
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Asic1 A G 15: 99,696,602 I310V probably benign Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cd96 G T 16: 46,117,805 T99K probably benign Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Pot1b A T 17: 55,687,939 I241N probably damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rgsl1 T A 1: 153,827,548 E154V probably damaging Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Other mutations in Abhd14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1332:Abhd14b UTSW 9 106451996 missense probably damaging 1.00
R2896:Abhd14b UTSW 9 106450114 missense probably benign 0.01
R7258:Abhd14b UTSW 9 106450219 missense probably benign 0.00
R7384:Abhd14b UTSW 9 106450141 missense probably benign
R7769:Abhd14b UTSW 9 106451620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGATCCTCAAGGCCTGG -3'
(R):5'- AGATTGGCTAAATCCTTCCAGTCC -3'

Sequencing Primer
(F):5'- GTGGACACCTAACTGCTCC -3'
(R):5'- GGCTAAATCCTTCCAGTCCTCCATC -3'
Posted On2015-01-23