Incidental Mutation 'R2895:Or11h23'
ID 260760
Institutional Source Beutler Lab
Gene Symbol Or11h23
Ensembl Gene ENSMUSG00000060084
Gene Name olfactory receptor family 11 subfamily G member 23
Synonyms GA_x6K02T2PMLR-6454789-6455712, Olfr748, MOR106-9P
MMRRC Submission 040483-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R2895 (G1)
Quality Score 222
Status Not validated
Chromosome 14
Chromosomal Location 50947789-50948712 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50947973 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 62 (F62S)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
AlphaFold E9Q9Z0
Predicted Effect probably damaging
Transcript: ENSMUST00000073561
AA Change: F62S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: F62S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213101
AA Change: F62S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,093,252 (GRCm39) V1007A probably benign Het
Abhd14b C T 9: 106,327,313 (GRCm39) R32C probably benign Het
Akirin1 T C 4: 123,631,864 (GRCm39) E168G probably damaging Het
Apol7e A T 15: 77,598,667 (GRCm39) D44V possibly damaging Het
Asic1 A G 15: 99,594,483 (GRCm39) I310V probably benign Het
Atp6v0a1 A G 11: 100,935,424 (GRCm39) H661R probably benign Het
Caskin1 A G 17: 24,708,016 (GRCm39) R25G probably damaging Het
Cd96 G T 16: 45,938,168 (GRCm39) T99K probably benign Het
Cep250 C A 2: 155,834,042 (GRCm39) A1989D probably benign Het
Clasp1 T G 1: 118,387,568 (GRCm39) V78G probably damaging Het
Cmklr2 T A 1: 63,222,321 (GRCm39) I305L probably benign Het
Col15a1 T C 4: 47,312,091 (GRCm39) V1302A possibly damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Cyb5r4 C T 9: 86,922,452 (GRCm39) Q154* probably null Het
Dnah7b T C 1: 46,178,901 (GRCm39) F858S probably damaging Het
Dysf G A 6: 84,163,491 (GRCm39) probably null Het
H3f3a C T 1: 180,630,703 (GRCm39) R117H probably benign Het
Igkv1-135 T A 6: 67,587,332 (GRCm39) S68T probably benign Het
Kmt2d G A 15: 98,741,820 (GRCm39) probably benign Het
Lonp1 A G 17: 56,922,562 (GRCm39) L688P probably damaging Het
Lpar6 A G 14: 73,476,716 (GRCm39) K226E probably damaging Het
Map3k19 T C 1: 127,749,835 (GRCm39) D968G possibly damaging Het
Med16 G A 10: 79,739,005 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mrps7 A G 11: 115,495,865 (GRCm39) M98V probably benign Het
Ms4a14 A T 19: 11,281,595 (GRCm39) I321N possibly damaging Het
Muc5ac A G 7: 141,344,877 (GRCm39) D116G possibly damaging Het
Neu1 A G 17: 35,151,758 (GRCm39) D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,069,791 (GRCm39) probably benign Het
Pcdh19 CTGTCTCCTCCA C X: 132,582,057 (GRCm39) probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 132,582,058 (GRCm39) probably null Het
Plcz1 A G 6: 139,968,877 (GRCm39) I187T possibly damaging Het
Pot1b A T 17: 55,994,939 (GRCm39) I241N probably damaging Het
Ppp4r3c1 A G X: 88,976,005 (GRCm39) M64T possibly damaging Het
Ptpre G A 7: 135,245,587 (GRCm39) W11* probably null Het
Rgsl1 T A 1: 153,703,294 (GRCm39) E154V probably damaging Het
Rnasel T C 1: 153,636,522 (GRCm39) I634T probably damaging Het
Scn10a A T 9: 119,490,467 (GRCm39) S492T probably benign Het
Sec24d T A 3: 123,136,800 (GRCm39) V511E probably damaging Het
Slc7a1 A G 5: 148,277,402 (GRCm39) I371T probably benign Het
Smg1 A G 7: 117,788,366 (GRCm39) probably benign Het
Sntg2 A T 12: 30,276,845 (GRCm39) S402R probably benign Het
Stfa3 C A 16: 36,272,522 (GRCm39) L59F probably benign Het
Tlr3 T C 8: 45,850,629 (GRCm39) E756G possibly damaging Het
Ttll4 T A 1: 74,724,517 (GRCm39) H562Q possibly damaging Het
Other mutations in Or11h23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Or11h23 APN 14 50,948,450 (GRCm39) missense possibly damaging 0.95
IGL02965:Or11h23 APN 14 50,948,653 (GRCm39) missense probably damaging 1.00
R0576:Or11h23 UTSW 14 50,948,661 (GRCm39) missense probably damaging 0.98
R1184:Or11h23 UTSW 14 50,948,071 (GRCm39) missense probably benign 0.01
R2129:Or11h23 UTSW 14 50,948,093 (GRCm39) missense probably damaging 0.99
R2896:Or11h23 UTSW 14 50,947,973 (GRCm39) missense probably damaging 0.99
R4017:Or11h23 UTSW 14 50,948,333 (GRCm39) missense probably benign 0.03
R5053:Or11h23 UTSW 14 50,947,968 (GRCm39) nonsense probably null
R5057:Or11h23 UTSW 14 50,948,669 (GRCm39) missense probably damaging 1.00
R5113:Or11h23 UTSW 14 50,948,371 (GRCm39) missense probably benign 0.00
R5294:Or11h23 UTSW 14 50,948,236 (GRCm39) missense probably benign 0.01
R5294:Or11h23 UTSW 14 50,947,900 (GRCm39) missense possibly damaging 0.95
R5499:Or11h23 UTSW 14 50,948,324 (GRCm39) missense probably damaging 1.00
R5582:Or11h23 UTSW 14 50,948,425 (GRCm39) missense probably damaging 1.00
R5727:Or11h23 UTSW 14 50,947,817 (GRCm39) missense possibly damaging 0.74
R6797:Or11h23 UTSW 14 50,948,563 (GRCm39) missense probably damaging 1.00
R7685:Or11h23 UTSW 14 50,948,215 (GRCm39) missense possibly damaging 0.95
R7717:Or11h23 UTSW 14 50,948,219 (GRCm39) missense probably damaging 1.00
R7778:Or11h23 UTSW 14 50,947,928 (GRCm39) missense possibly damaging 0.60
R8276:Or11h23 UTSW 14 50,948,287 (GRCm39) missense probably benign 0.28
R8839:Or11h23 UTSW 14 50,947,957 (GRCm39) missense possibly damaging 0.73
R9322:Or11h23 UTSW 14 50,948,507 (GRCm39) missense probably damaging 1.00
R9358:Or11h23 UTSW 14 50,947,802 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGTGTCAGAGGGATCCAC -3'
(R):5'- GAATTGCCTAGTCATGATGGAAGG -3'

Sequencing Primer
(F):5'- AGAGGGATCCACGGTGACATATTTTG -3'
(R):5'- TGGCTAGGTACCGATCATAAGCC -3'
Posted On 2015-01-23