Incidental Mutation 'R2895:Olfr748'
ID260760
Institutional Source Beutler Lab
Gene Symbol Olfr748
Ensembl Gene ENSMUSG00000060084
Gene Nameolfactory receptor 748
SynonymsGA_x6K02T2PMLR-6454789-6455712, MOR106-9P
MMRRC Submission 040483-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2895 (G1)
Quality Score222
Status Not validated
Chromosome14
Chromosomal Location50707373-50713797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50710516 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 62 (F62S)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
Predicted Effect probably damaging
Transcript: ENSMUST00000073561
AA Change: F62S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: F62S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213101
AA Change: F62S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Asic1 A G 15: 99,696,602 I310V probably benign Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cd96 G T 16: 46,117,805 T99K probably benign Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Pot1b A T 17: 55,687,939 I241N probably damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rgsl1 T A 1: 153,827,548 E154V probably damaging Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Other mutations in Olfr748
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Olfr748 APN 14 50710993 missense possibly damaging 0.95
IGL02965:Olfr748 APN 14 50711196 missense probably damaging 1.00
R0576:Olfr748 UTSW 14 50711204 missense probably damaging 0.98
R1184:Olfr748 UTSW 14 50710614 missense probably benign 0.01
R2129:Olfr748 UTSW 14 50710636 missense probably damaging 0.99
R2896:Olfr748 UTSW 14 50710516 missense probably damaging 0.99
R4017:Olfr748 UTSW 14 50710876 missense probably benign 0.03
R5053:Olfr748 UTSW 14 50710511 nonsense probably null
R5057:Olfr748 UTSW 14 50711212 missense probably damaging 1.00
R5113:Olfr748 UTSW 14 50710914 missense probably benign 0.00
R5294:Olfr748 UTSW 14 50710443 missense possibly damaging 0.95
R5294:Olfr748 UTSW 14 50710779 missense probably benign 0.01
R5499:Olfr748 UTSW 14 50710867 missense probably damaging 1.00
R5582:Olfr748 UTSW 14 50710968 missense probably damaging 1.00
R5727:Olfr748 UTSW 14 50710360 missense possibly damaging 0.74
R6797:Olfr748 UTSW 14 50711106 missense probably damaging 1.00
R7685:Olfr748 UTSW 14 50710758 missense possibly damaging 0.95
R7717:Olfr748 UTSW 14 50710762 missense probably damaging 1.00
R7778:Olfr748 UTSW 14 50710471 missense possibly damaging 0.60
R8276:Olfr748 UTSW 14 50710830 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AACGTGTCAGAGGGATCCAC -3'
(R):5'- GAATTGCCTAGTCATGATGGAAGG -3'

Sequencing Primer
(F):5'- AGAGGGATCCACGGTGACATATTTTG -3'
(R):5'- TGGCTAGGTACCGATCATAAGCC -3'
Posted On2015-01-23