Incidental Mutation 'R2895:Asic1'
ID260765
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Nameacid-sensing (proton-gated) ion channel 1
SynonymsASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta
MMRRC Submission 040483-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R2895 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99670368-99701130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99696602 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 310 (I310V)
Ref Sequence ENSEMBL: ENSMUSP00000023758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000228185]
Predicted Effect probably benign
Transcript: ENSMUST00000023758
AA Change: I310V

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017
AA Change: I310V

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228012
Predicted Effect probably benign
Transcript: ENSMUST00000228185
AA Change: I343V

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228610
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cd96 G T 16: 46,117,805 T99K probably benign Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Pot1b A T 17: 55,687,939 I241N probably damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rgsl1 T A 1: 153,827,548 E154V probably damaging Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01418:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01718:Asic1 APN 15 99672002 missense probably damaging 1.00
IGL01941:Asic1 APN 15 99699101 missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99697472 missense probably benign 0.01
IGL02097:Asic1 APN 15 99694686 splice site probably benign
IGL03028:Asic1 APN 15 99672157 missense probably benign 0.03
IGL03082:Asic1 APN 15 99696547 missense probably benign
IGL03183:Asic1 APN 15 99672017 missense probably benign 0.43
IGL03231:Asic1 APN 15 99699102 missense probably benign 0.42
R0111:Asic1 UTSW 15 99696983 missense probably damaging 1.00
R0243:Asic1 UTSW 15 99698617 unclassified probably benign
R0316:Asic1 UTSW 15 99671938 missense probably benign 0.03
R0518:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0520:Asic1 UTSW 15 99695535 missense probably damaging 1.00
R0521:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0610:Asic1 UTSW 15 99698899 missense probably benign 0.14
R1034:Asic1 UTSW 15 99698058 missense probably damaging 1.00
R1666:Asic1 UTSW 15 99699125 missense probably damaging 1.00
R1796:Asic1 UTSW 15 99696654 missense probably null 0.99
R1993:Asic1 UTSW 15 99671884 missense probably damaging 1.00
R2130:Asic1 UTSW 15 99671875 missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99671965 missense probably benign
R3793:Asic1 UTSW 15 99672025 nonsense probably null
R3848:Asic1 UTSW 15 99672933 missense probably benign 0.01
R5115:Asic1 UTSW 15 99672052 missense probably damaging 0.97
R5186:Asic1 UTSW 15 99698803 unclassified probably benign
R5187:Asic1 UTSW 15 99698803 unclassified probably benign
R5409:Asic1 UTSW 15 99698803 unclassified probably benign
R6011:Asic1 UTSW 15 99699079 missense probably benign 0.05
R6383:Asic1 UTSW 15 99698880 missense probably damaging 0.96
R7133:Asic1 UTSW 15 99672087 missense probably damaging 1.00
R7255:Asic1 UTSW 15 99697457 missense probably damaging 0.97
R7587:Asic1 UTSW 15 99695590 missense probably damaging 1.00
R8012:Asic1 UTSW 15 99696651 missense possibly damaging 0.92
R8030:Asic1 UTSW 15 99694841 missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99698087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGTAAGACTCCCAAGATC -3'
(R):5'- TACTCCCTGCAGACATAGGC -3'

Sequencing Primer
(F):5'- GATCCATATCTTGGCAGAGAAGTCC -3'
(R):5'- TGCAGACATAGGCAGGGACC -3'
Posted On2015-01-23