Incidental Mutation 'R2895:Pot1b'
ID260771
Institutional Source Beutler Lab
Gene Symbol Pot1b
Ensembl Gene ENSMUSG00000024174
Gene Nameprotection of telomeres 1B
Synonyms
MMRRC Submission 040483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2895 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location55652025-55712628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55687939 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 241 (I241N)
Ref Sequence ENSEMBL: ENSMUSP00000084089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086876]
Predicted Effect probably damaging
Transcript: ENSMUST00000086876
AA Change: I241N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084089
Gene: ENSMUSG00000024174
AA Change: I241N

DomainStartEndE-ValueType
Telo_bind 11 141 1.74e-51 SMART
Pfam:POT1PC 152 299 7.9e-40 PFAM
low complexity region 313 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null mutation display male infertility with age, male germ cell apoptosis, hyperpigmentation, increased apoptosis in intestinal crypts, and decreased body size. Mice homozygous for a transgenic gene disruption exhibit neonatal lethality with possible stem cell defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Asic1 A G 15: 99,696,602 I310V probably benign Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cd96 G T 16: 46,117,805 T99K probably benign Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rgsl1 T A 1: 153,827,548 E154V probably damaging Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Other mutations in Pot1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Pot1b APN 17 55695160 missense possibly damaging 0.94
IGL01796:Pot1b APN 17 55669750 missense possibly damaging 0.53
IGL01810:Pot1b APN 17 55662521 missense possibly damaging 0.68
IGL02371:Pot1b APN 17 55695092 missense possibly damaging 0.91
IGL02553:Pot1b APN 17 55695024 splice site probably benign
IGL02957:Pot1b APN 17 55700009 missense probably damaging 0.99
IGL02975:Pot1b APN 17 55662454 splice site probably benign
IGL03172:Pot1b APN 17 55695206 missense possibly damaging 0.60
boulder UTSW 17 55672865 nonsense probably null
erosion UTSW 17 55687834 missense probably damaging 0.99
G1Funyon:Pot1b UTSW 17 55687895 missense probably benign
R0020:Pot1b UTSW 17 55653429 missense probably benign 0.03
R0540:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0607:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0882:Pot1b UTSW 17 55666400 splice site probably benign
R1164:Pot1b UTSW 17 55674085 missense probably benign 0.18
R1476:Pot1b UTSW 17 55653451 missense possibly damaging 0.73
R1874:Pot1b UTSW 17 55654805 missense probably benign
R1955:Pot1b UTSW 17 55674067 missense possibly damaging 0.73
R1960:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R1961:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R2109:Pot1b UTSW 17 55653413 missense probably benign 0.00
R2943:Pot1b UTSW 17 55674058 missense probably benign
R4681:Pot1b UTSW 17 55654831 missense probably benign 0.28
R4763:Pot1b UTSW 17 55695160 missense possibly damaging 0.94
R4821:Pot1b UTSW 17 55672885 missense possibly damaging 0.73
R5079:Pot1b UTSW 17 55669801 missense probably benign 0.18
R5146:Pot1b UTSW 17 55672865 nonsense probably null
R5176:Pot1b UTSW 17 55699995 missense probably benign 0.05
R5394:Pot1b UTSW 17 55700063 missense probably benign 0.19
R5752:Pot1b UTSW 17 55687834 missense probably damaging 0.99
R6866:Pot1b UTSW 17 55653474 missense possibly damaging 0.83
R8301:Pot1b UTSW 17 55687895 missense probably benign
R8390:Pot1b UTSW 17 55692739 missense probably benign 0.00
R8750:Pot1b UTSW 17 55666537 missense probably benign
RF014:Pot1b UTSW 17 55674106 missense probably benign 0.12
X0062:Pot1b UTSW 17 55695154 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAGATTCTCAGCAAGGCAAAGAGG -3'
(R):5'- CCTGGAAGCAGCAGAACTTG -3'

Sequencing Primer
(F):5'- TGCCTCAAACATTACAGAAAGTGTGC -3'
(R):5'- CAGCAGAACTTGGCAGCTTTG -3'
Posted On2015-01-23