Incidental Mutation 'R2895:4930415L06Rik'
ID260776
Institutional Source Beutler Lab
Gene Symbol 4930415L06Rik
Ensembl Gene ENSMUSG00000035387
Gene NameRIKEN cDNA 4930415L06 gene
Synonyms
MMRRC Submission 040483-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R2895 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location89930098-89932852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89932399 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 64 (M64T)
Ref Sequence ENSEMBL: ENSMUSP00000085471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088146
AA Change: M64T

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085471
Gene: ENSMUSG00000035387
AA Change: M64T

DomainStartEndE-ValueType
SCOP:d1k5db_ 18 107 1e-22 SMART
Pfam:SMK-1 178 369 9e-72 PFAM
low complexity region 650 663 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Asic1 A G 15: 99,696,602 I310V probably benign Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cd96 G T 16: 46,117,805 T99K probably benign Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Pot1b A T 17: 55,687,939 I241N probably damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rgsl1 T A 1: 153,827,548 E154V probably damaging Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Other mutations in 4930415L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:4930415L06Rik APN X 89931523 missense probably benign 0.17
IGL02226:4930415L06Rik APN X 89931912 missense probably damaging 0.99
R1980:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1981:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1982:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R2299:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R2381:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R2896:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R4001:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R4003:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R4042:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4043:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4280:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4281:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4282:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
Z1088:4930415L06Rik UTSW X 89930236 missense unknown
Z1088:4930415L06Rik UTSW X 89930237 missense unknown
Z1176:4930415L06Rik UTSW X 89930241 missense unknown
Predicted Primers PCR Primer
(F):5'- TGATTTCTACATGTGGGTCTTTACC -3'
(R):5'- GACAGCAACTTCTGGCAAGTG -3'

Sequencing Primer
(F):5'- CTTGAATCTGGCAGATATCTTCCCAG -3'
(R):5'- TCTGCAAAATGACGTGGCC -3'
Posted On2015-01-23