Incidental Mutation 'R2896:Rdh10'
ID260779
Institutional Source Beutler Lab
Gene Symbol Rdh10
Ensembl Gene ENSMUSG00000025921
Gene Nameretinol dehydrogenase 10 (all-trans)
Synonyms3110069K09Rik, D1Ertd762e, 4921506A21Rik, m366Asp
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location16105774-16133734 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 16106105 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027053] [ENSMUST00000058437]
Predicted Effect probably null
Transcript: ENSMUST00000027053
AA Change: K30*
SMART Domains Protein: ENSMUSP00000027053
Gene: ENSMUSG00000025921
AA Change: K30*

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:KR 37 231 3.1e-8 PFAM
Pfam:adh_short 90 259 1.8e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000058437
SMART Domains Protein: ENSMUSP00000071616
Gene: ENSMUSG00000043716

DomainStartEndE-ValueType
Pfam:Ribosomal_L30_N 39 109 4.5e-31 PFAM
Pfam:Ribosomal_L30 112 162 1.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141217
Predicted Effect probably null
Transcript: ENSMUST00000149566
SMART Domains Protein: ENSMUSP00000118695
Gene: ENSMUSG00000043716

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Pfam:Ribosomal_L30_N 65 135 2.1e-31 PFAM
Pfam:Ribosomal_L30 138 188 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151017
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinol dehydrogenase, which converts all-trans-retinol to all-trans-retinal, with preference for NADP as a cofactor. Studies in mice suggest that this protein is essential for synthesis of embryonic retinoic acid and is required for limb, craniofacial, and organ development. [provided by RefSeq, Dec 2011]
PHENOTYPE: Embryos homozygous for null or hypomorphic alleles exhibit mid-gestational lethality, reduced Retinoic Acid signaling and abnormal limb, craniofacial, somite and cardiac morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Rdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Rdh10 APN 1 16107875 missense probably benign
IGL01646:Rdh10 APN 1 16108022 missense possibly damaging 0.90
IGL01820:Rdh10 APN 1 16128259 missense possibly damaging 0.84
IGL02377:Rdh10 APN 1 16106214 nonsense probably null
IGL03212:Rdh10 APN 1 16107827 missense probably benign 0.03
R0039:Rdh10 UTSW 1 16129284 missense probably damaging 0.97
R0042:Rdh10 UTSW 1 16108036 unclassified probably benign
R0042:Rdh10 UTSW 1 16108036 unclassified probably benign
R0109:Rdh10 UTSW 1 16106265 missense probably damaging 0.97
R0569:Rdh10 UTSW 1 16129293 missense probably damaging 1.00
R1272:Rdh10 UTSW 1 16108016 missense probably damaging 1.00
R1633:Rdh10 UTSW 1 16128196 missense possibly damaging 0.90
R4623:Rdh10 UTSW 1 16131063 splice site probably benign
R5095:Rdh10 UTSW 1 16131385 missense probably benign 0.01
R5158:Rdh10 UTSW 1 16107997 missense probably damaging 1.00
R5535:Rdh10 UTSW 1 16131184 missense probably damaging 1.00
R6433:Rdh10 UTSW 1 16107855 missense probably damaging 0.98
R6778:Rdh10 UTSW 1 16106184 missense probably damaging 0.99
R6922:Rdh10 UTSW 1 16106031 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGTTGACAACTCCCGC -3'
(R):5'- TTACCTTGCAGAGCAGCAGC -3'

Sequencing Primer
(F):5'- TAACTCGCGGCTGTCACC -3'
(R):5'- GTTGATGTCCCAGAGAAC -3'
Posted On2015-01-23