Incidental Mutation 'R2896:Gpr1'
ID260780
Institutional Source Beutler Lab
Gene Symbol Gpr1
Ensembl Gene ENSMUSG00000046856
Gene NameG protein-coupled receptor 1
Synonyms
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63182691-63214543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63183162 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 305 (I305L)
Ref Sequence ENSEMBL: ENSMUSP00000051417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027108] [ENSMUST00000050536] [ENSMUST00000129339] [ENSMUST00000135877] [ENSMUST00000142062] [ENSMUST00000174890] [ENSMUST00000188524]
Predicted Effect probably benign
Transcript: ENSMUST00000027108
Predicted Effect probably benign
Transcript: ENSMUST00000050536
AA Change: I305L

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051417
Gene: ENSMUSG00000046856
AA Change: I305L

DomainStartEndE-ValueType
Pfam:7tm_1 55 302 3.9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126469
Predicted Effect probably benign
Transcript: ENSMUST00000126795
SMART Domains Protein: ENSMUSP00000134341
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
SCOP:d1aw9_1 4 62 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129339
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135877
SMART Domains Protein: ENSMUSP00000137671
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148553
Predicted Effect probably benign
Transcript: ENSMUST00000174890
SMART Domains Protein: ENSMUSP00000133545
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
Blast:WHEP 3 64 3e-6 BLAST
SCOP:d1aw9_1 7 65 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199062
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Gpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Gpr1 APN 1 63183338 missense probably damaging 0.99
IGL01086:Gpr1 APN 1 63183491 missense probably benign 0.01
IGL01490:Gpr1 APN 1 63183296 missense probably damaging 0.99
IGL02409:Gpr1 APN 1 63183716 missense probably damaging 1.00
IGL02426:Gpr1 APN 1 63183668 missense probably damaging 0.97
R0218:Gpr1 UTSW 1 63183531 missense probably benign 0.25
R2088:Gpr1 UTSW 1 63183652 unclassified probably null
R2166:Gpr1 UTSW 1 63183948 missense probably benign
R2895:Gpr1 UTSW 1 63183162 missense probably benign 0.24
R5102:Gpr1 UTSW 1 63183167 missense probably damaging 0.99
R5131:Gpr1 UTSW 1 63183681 missense probably damaging 1.00
R5471:Gpr1 UTSW 1 63183899 missense probably damaging 1.00
R5652:Gpr1 UTSW 1 63183467 missense probably benign 0.00
R6187:Gpr1 UTSW 1 63183275 missense probably damaging 1.00
X0060:Gpr1 UTSW 1 63183059 missense probably benign 0.02
Z1177:Gpr1 UTSW 1 63183639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGTGGATCAGAATGCAAC -3'
(R):5'- GATCCTGTCTGTGGTCATTGCC -3'

Sequencing Primer
(F):5'- GGCTCACATGAAAACTTTGCACTG -3'
(R):5'- GCCTTCTTGGTTTGCTGGACC -3'
Posted On2015-01-23