Mutagenetix > Incidental Mutation

Incidental Mutation 'R2896:Kif21b'

260782

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

2610511N21Rik, N-5 kinesin

MMRRC Submission

040484-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R2896 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136059127-136105736 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136081955 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 668 (Y668H)

Ref Sequence

ENSEMBL: ENSMUSP00000074661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075164
AA Change: Y668H

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: Y668H

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122892

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130864
AA Change: Y668H

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: Y668H

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Meta Mutation Damage Score

0.1634

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd14b	C	T	9: 106,327,313 (GRCm39)	R32C	probably benign	Het
Bpifb4	T	G	2: 153,796,357 (GRCm39)		probably benign	Het
Cachd1	T	A	4: 100,828,100 (GRCm39)	L616Q	probably damaging	Het
Cmklr2	T	A	1: 63,222,321 (GRCm39)	I305L	probably benign	Het
Crebbp	A	G	16: 3,956,680 (GRCm39)	L381P	probably damaging	Het
Crygs	C	T	16: 22,624,301 (GRCm39)	G102D	possibly damaging	Het
Esp6	T	A	17: 40,873,834 (GRCm39)	M7K	possibly damaging	Het
Fam83d	G	A	2: 158,627,898 (GRCm39)	R529Q	probably damaging	Het
Gm26526	T	G	7: 39,238,437 (GRCm39)		noncoding transcript	Het
Gm8374	T	A	14: 18,537,084 (GRCm39)	R47*	probably null	Het
Gss	A	G	2: 155,406,749 (GRCm39)	L342P	probably damaging	Het
Ighv1-67	T	A	12: 115,567,595 (GRCm39)	T106S	probably damaging	Het
Lcmt1	A	G	7: 123,020,809 (GRCm39)	R245G	possibly damaging	Het
Lpar6	A	G	14: 73,476,716 (GRCm39)	K226E	probably damaging	Het
Or11h23	T	C	14: 50,947,973 (GRCm39)	F62S	probably damaging	Het
Pcdh19	TGTCTCCTCCACGTC	TGTC	X: 132,582,058 (GRCm39)		probably null	Het
Pdcl	A	T	2: 37,245,702 (GRCm39)	D100E	possibly damaging	Het
Phkg1	C	A	5: 129,893,471 (GRCm39)	K326N	possibly damaging	Het
Ppp4r3c1	A	G	X: 88,976,005 (GRCm39)	M64T	possibly damaging	Het
Prss1	G	A	6: 41,440,639 (GRCm39)	W238*	probably null	Het
Rdh10	A	T	1: 16,176,329 (GRCm39)		probably null	Het
Ror1	T	C	4: 99,953,477 (GRCm39)	L21P	unknown	Het
Skint8	A	G	4: 111,807,333 (GRCm39)	I340V	probably null	Het
Spata18	T	C	5: 73,815,145 (GRCm39)	S85P	probably damaging	Het
Stard6	G	A	18: 70,609,459 (GRCm39)	V33I	probably benign	Het
Ttll3	G	T	6: 113,369,683 (GRCm39)	A76S	probably benign	Het
Ttll4	T	A	1: 74,724,517 (GRCm39)	H562Q	possibly damaging	Het
Ubn1	A	G	16: 4,873,083 (GRCm39)	H35R	possibly damaging	Het
Ubr4	A	G	4: 139,182,955 (GRCm39)		probably null	Het
Zfp456	T	C	13: 67,515,416 (GRCm39)	R97G	possibly damaging	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136,080,080 (GRCm39)	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136,081,832 (GRCm39)	splice site	probably benign
IGL01288:Kif21b	APN	1	136,099,922 (GRCm39)	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136,099,041 (GRCm39)	missense	probably benign
IGL02264:Kif21b	APN	1	136,087,495 (GRCm39)	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136,087,495 (GRCm39)	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136,087,495 (GRCm39)	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136,087,495 (GRCm39)	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136,079,005 (GRCm39)	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136,081,859 (GRCm39)	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136,100,605 (GRCm39)	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136,099,968 (GRCm39)	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136,086,093 (GRCm39)	unclassified	probably benign
IGL03230:Kif21b	APN	1	136,090,550 (GRCm39)	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136,099,895 (GRCm39)	critical splice acceptor site	probably null
Schiessen	UTSW	1	136,075,607 (GRCm39)	critical splice donor site	probably null
wolfen	UTSW	1	136,072,496 (GRCm39)	nonsense	probably null
R0190:Kif21b	UTSW	1	136,098,957 (GRCm39)	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136,077,049 (GRCm39)	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136,090,837 (GRCm39)	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136,087,166 (GRCm39)	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136,099,895 (GRCm39)	critical splice acceptor site	probably null
R0741:Kif21b	UTSW	1	136,087,482 (GRCm39)	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136,090,561 (GRCm39)	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136,080,114 (GRCm39)	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136,083,891 (GRCm39)	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136,083,891 (GRCm39)	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136,097,062 (GRCm39)	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136,080,543 (GRCm39)	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136,083,849 (GRCm39)	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136,077,055 (GRCm39)	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136,099,423 (GRCm39)	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136,098,958 (GRCm39)	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136,099,023 (GRCm39)	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136,087,859 (GRCm39)	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136,083,880 (GRCm39)	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136,087,859 (GRCm39)	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136,075,531 (GRCm39)	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136,075,583 (GRCm39)	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136,098,894 (GRCm39)	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136,075,284 (GRCm39)	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136,075,284 (GRCm39)	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136,075,284 (GRCm39)	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136,080,002 (GRCm39)	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136,089,508 (GRCm39)	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136,076,020 (GRCm39)	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136,088,051 (GRCm39)	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136,080,002 (GRCm39)	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136,100,704 (GRCm39)	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136,075,612 (GRCm39)	splice site	probably benign
R3706:Kif21b	UTSW	1	136,087,148 (GRCm39)	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136,083,964 (GRCm39)	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136,090,732 (GRCm39)	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136,081,831 (GRCm39)	splice site	probably null
R4600:Kif21b	UTSW	1	136,075,602 (GRCm39)	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136,075,924 (GRCm39)	intron	probably benign
R4749:Kif21b	UTSW	1	136,072,487 (GRCm39)	nonsense	probably null
R4841:Kif21b	UTSW	1	136,072,958 (GRCm39)	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136,072,958 (GRCm39)	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136,079,063 (GRCm39)	splice site	probably null
R4959:Kif21b	UTSW	1	136,076,108 (GRCm39)	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136,099,972 (GRCm39)	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136,080,521 (GRCm39)	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136,090,838 (GRCm39)	missense	probably benign
R5197:Kif21b	UTSW	1	136,072,363 (GRCm39)	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136,099,411 (GRCm39)	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136,096,966 (GRCm39)	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136,098,881 (GRCm39)	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136,100,030 (GRCm39)	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136,075,263 (GRCm39)	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136,097,797 (GRCm39)	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136,097,747 (GRCm39)	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136,078,875 (GRCm39)	nonsense	probably null
R5929:Kif21b	UTSW	1	136,078,945 (GRCm39)	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136,077,156 (GRCm39)	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136,086,064 (GRCm39)	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136,080,135 (GRCm39)	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136,072,496 (GRCm39)	nonsense	probably null
R7156:Kif21b	UTSW	1	136,075,562 (GRCm39)	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136,077,186 (GRCm39)	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136,087,387 (GRCm39)	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136,075,607 (GRCm39)	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136,098,911 (GRCm39)	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136,100,683 (GRCm39)	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136,100,021 (GRCm39)	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136,073,042 (GRCm39)	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136,078,893 (GRCm39)	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136,100,559 (GRCm39)	nonsense	probably null
R9261:Kif21b	UTSW	1	136,077,162 (GRCm39)	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136,099,445 (GRCm39)	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136,101,800 (GRCm39)	missense	probably benign
R9562:Kif21b	UTSW	1	136,077,090 (GRCm39)	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136,077,166 (GRCm39)	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136,077,090 (GRCm39)	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136,080,961 (GRCm39)	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136,076,421 (GRCm39)	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136,086,079 (GRCm39)	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136,077,054 (GRCm39)	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136,100,683 (GRCm39)	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136,081,875 (GRCm39)	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136,076,050 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGCTGACCAAAGGATGC -3'
(R):5'- AACTACGGGCCAAAGGTCAC -3'

Sequencing Primer
(F):5'- ACACTCAAACTGTCTAGACTTCTC -3'
(R):5'- AAAGGTCACGGTGCTTCG -3'

Posted On

2015-01-23