Incidental Mutation 'R2896:Bpifb4'
ID260785
Institutional Source Beutler Lab
Gene Symbol Bpifb4
Ensembl Gene ENSMUSG00000074665
Gene NameBPI fold containing family B, member 4
SynonymsLOC381399, Gm1006
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153938212-153964101 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 153954437 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099181] [ENSMUST00000109757] [ENSMUST00000109759]
Predicted Effect probably benign
Transcript: ENSMUST00000099181
SMART Domains Protein: ENSMUSP00000096786
Gene: ENSMUSG00000074665

DomainStartEndE-ValueType
BPI1 2 177 3.47e-25 SMART
BPI2 201 403 3.62e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109757
SMART Domains Protein: ENSMUSP00000105379
Gene: ENSMUSG00000074665

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 171 391 1.23e-48 SMART
BPI2 415 617 3.62e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109759
SMART Domains Protein: ENSMUSP00000105381
Gene: ENSMUSG00000074665

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 171 391 1.23e-48 SMART
BPI2 415 617 3.62e-78 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Bpifb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Bpifb4 APN 2 153947278 splice site probably benign
IGL01641:Bpifb4 APN 2 153942681 missense possibly damaging 0.96
IGL01653:Bpifb4 APN 2 153944783 missense probably damaging 1.00
IGL02745:Bpifb4 APN 2 153947221 missense probably damaging 1.00
R0106:Bpifb4 UTSW 2 153940968 missense probably benign 0.02
R0309:Bpifb4 UTSW 2 153959683 missense probably damaging 0.97
R0561:Bpifb4 UTSW 2 153944822 missense probably damaging 1.00
R0601:Bpifb4 UTSW 2 153947283 splice site probably benign
R1937:Bpifb4 UTSW 2 153944076 missense probably damaging 0.98
R2433:Bpifb4 UTSW 2 153959677 missense probably damaging 0.98
R2679:Bpifb4 UTSW 2 153948624 missense probably damaging 0.97
R4701:Bpifb4 UTSW 2 153950385 missense probably damaging 1.00
R4772:Bpifb4 UTSW 2 153942983 missense possibly damaging 0.93
R5403:Bpifb4 UTSW 2 153943992 missense probably damaging 0.99
R5695:Bpifb4 UTSW 2 153942923 missense probably damaging 0.99
R5894:Bpifb4 UTSW 2 153940932 missense possibly damaging 0.49
R6007:Bpifb4 UTSW 2 153942560 missense possibly damaging 0.49
R6302:Bpifb4 UTSW 2 153959667 missense probably benign 0.00
R6351:Bpifb4 UTSW 2 153957134 missense probably damaging 0.96
R6755:Bpifb4 UTSW 2 153957738 missense probably damaging 0.98
R6796:Bpifb4 UTSW 2 153961547 missense probably damaging 1.00
R6932:Bpifb4 UTSW 2 153942627 missense possibly damaging 0.49
R7489:Bpifb4 UTSW 2 153944004 missense probably damaging 1.00
RF061:Bpifb4 UTSW 2 153957128 critical splice acceptor site probably benign
X0018:Bpifb4 UTSW 2 153944061 missense probably damaging 1.00
Z1176:Bpifb4 UTSW 2 153942832 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTTCCAGCAATACCCGGAATCC -3'
(R):5'- TAATGCCCAGCTGACACTCC -3'

Sequencing Primer
(F):5'- GGAATCCCGCCCACTCAC -3'
(R):5'- CAGCTGACACTCCTCAAGG -3'
Posted On2015-01-23