Incidental Mutation 'R2896:Gss'
ID260786
Institutional Source Beutler Lab
Gene Symbol Gss
Ensembl Gene ENSMUSG00000027610
Gene Nameglutathione synthetase
SynonymsGS-A/GS-B
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155563181-155592810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155564829 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 342 (L342P)
Ref Sequence ENSEMBL: ENSMUSP00000135319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029135] [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000103142] [ENSMUST00000130881] [ENSMUST00000133654]
Predicted Effect probably benign
Transcript: ENSMUST00000029135
SMART Domains Protein: ENSMUSP00000029135
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 1.9e-96 PFAM
Pfam:AMP-binding_C 583 661 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065973
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079691
AA Change: L411P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610
AA Change: L411P

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 12 472 6.7e-131 PFAM
Pfam:GSH_synthase 204 302 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103142
SMART Domains Protein: ENSMUSP00000099431
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:ACAS_N 47 107 8.1e-21 PFAM
Pfam:AMP-binding 108 588 4.7e-97 PFAM
Pfam:AMP-binding_C 596 674 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130881
AA Change: L342P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610
AA Change: L342P

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 404 9.2e-130 PFAM
Pfam:GSH_synthase 133 233 9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153975
Predicted Effect probably damaging
Transcript: ENSMUST00000175993
AA Change: L152P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9687 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation all die before E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Gss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Gss APN 2 155581951 missense probably damaging 1.00
IGL01737:Gss APN 2 155567806 missense probably damaging 1.00
IGL01783:Gss APN 2 155571559 missense probably damaging 1.00
IGL02329:Gss APN 2 155567853 missense probably benign 0.01
IGL02386:Gss APN 2 155573170 missense probably benign 0.01
IGL02948:Gss APN 2 155577621 missense probably damaging 1.00
PIT4515001:Gss UTSW 2 155578341 missense probably damaging 1.00
R0230:Gss UTSW 2 155578406 missense probably damaging 1.00
R0446:Gss UTSW 2 155567745 missense probably benign 0.00
R0931:Gss UTSW 2 155567689 intron probably benign
R1396:Gss UTSW 2 155567721 missense probably damaging 0.99
R2986:Gss UTSW 2 155587443 missense probably benign 0.21
R4852:Gss UTSW 2 155564865 missense probably benign 0.06
R5148:Gss UTSW 2 155573109 missense possibly damaging 0.80
R6017:Gss UTSW 2 155587465 missense probably benign
R6574:Gss UTSW 2 155582011 missense probably damaging 1.00
R6868:Gss UTSW 2 155567812 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AAACTGAACCTGGGGCTCATG -3'
(R):5'- CCAAGCAGAACAGTGTGGTG -3'

Sequencing Primer
(F):5'- ATGGCTCTGTCCACGGTTCAG -3'
(R):5'- AAAGCTCTCTTGTCAAGGTGTTC -3'
Posted On2015-01-23