Incidental Mutation 'R2896:Skint8'
ID260790
Institutional Source Beutler Lab
Gene Symbol Skint8
Ensembl Gene ENSMUSG00000078599
Gene Nameselection and upkeep of intraepithelial T cells 8
SynonymsOTTMUSG00000009475
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location111919392-111950358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111950136 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 340 (I340V)
Ref Sequence ENSEMBL: ENSMUSP00000133268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165046]
Predicted Effect probably null
Transcript: ENSMUST00000165046
AA Change: I340V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133268
Gene: ENSMUSG00000078599
AA Change: I340V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 3.13e-5 SMART
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 352 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Skint8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Skint8 APN 4 111938923 missense probably benign 0.05
IGL01411:Skint8 APN 4 111936906 missense probably damaging 0.97
IGL02973:Skint8 APN 4 111939593 missense probably benign 0.09
IGL03154:Skint8 APN 4 111939510 splice site probably null
FR4976:Skint8 UTSW 4 111938902 missense probably benign 0.02
R0309:Skint8 UTSW 4 111938867 missense probably benign 0.02
R0448:Skint8 UTSW 4 111936890 missense probably damaging 1.00
R0483:Skint8 UTSW 4 111938823 splice site probably benign
R0586:Skint8 UTSW 4 111936929 missense probably damaging 1.00
R1076:Skint8 UTSW 4 111927219 missense probably damaging 1.00
R1169:Skint8 UTSW 4 111928513 missense possibly damaging 0.86
R1588:Skint8 UTSW 4 111928727 nonsense probably null
R1707:Skint8 UTSW 4 111939572 missense probably damaging 1.00
R1865:Skint8 UTSW 4 111936995 missense probably damaging 1.00
R1954:Skint8 UTSW 4 111950081 missense possibly damaging 0.54
R2147:Skint8 UTSW 4 111937077 missense probably damaging 1.00
R4945:Skint8 UTSW 4 111939608 missense probably damaging 0.96
R5019:Skint8 UTSW 4 111928648 missense probably damaging 0.99
R5281:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5284:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5289:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5309:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5310:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5588:Skint8 UTSW 4 111936892 missense probably benign 0.01
R5636:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5637:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5638:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5639:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5719:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5720:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5754:Skint8 UTSW 4 111950190 missense probably benign
R5850:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5855:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6036:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6525:Skint8 UTSW 4 111928738 missense probably damaging 0.98
R6554:Skint8 UTSW 4 111927216 missense probably benign 0.35
R6578:Skint8 UTSW 4 111936962 missense probably benign 0.03
R6841:Skint8 UTSW 4 111928771 missense probably damaging 1.00
R7000:Skint8 UTSW 4 111937025 missense probably benign 0.16
R7317:Skint8 UTSW 4 111939520 missense possibly damaging 0.94
R7336:Skint8 UTSW 4 111939572 missense probably benign 0.32
R7412:Skint8 UTSW 4 111928561 missense probably benign 0.07
R7480:Skint8 UTSW 4 111928587 nonsense probably null
R8027:Skint8 UTSW 4 111928739 missense probably benign 0.36
Z1177:Skint8 UTSW 4 111937054 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GACATTTGGTAGCATGCAAAGG -3'
(R):5'- TCTGTGCTAGAAGACCTAGGC -3'

Sequencing Primer
(F):5'- GGTAGCATGCAAAGGAATATTAAATG -3'
(R):5'- TGACACTGGCCAATCAGTTG -3'
Posted On2015-01-23