Incidental Mutation 'R2896:Phkg1'
ID260793
Institutional Source Beutler Lab
Gene Symbol Phkg1
Ensembl Gene ENSMUSG00000025537
Gene Namephosphorylase kinase gamma 1
Synonyms
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129863421-129898549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129864630 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 326 (K326N)
Ref Sequence ENSEMBL: ENSMUSP00000026617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026617] [ENSMUST00000137357] [ENSMUST00000140667] [ENSMUST00000154932] [ENSMUST00000171300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026617
AA Change: K326N

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026617
Gene: ENSMUSG00000025537
AA Change: K326N

DomainStartEndE-ValueType
S_TKc 20 288 3.79e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122826
Predicted Effect probably benign
Transcript: ENSMUST00000137357
SMART Domains Protein: ENSMUSP00000144155
Gene: ENSMUSG00000025538

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:FGE-sulfatase 25 136 6.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154495
Predicted Effect probably benign
Transcript: ENSMUST00000154932
SMART Domains Protein: ENSMUSP00000122040
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 95 3.6e-13 PFAM
Pfam:Pkinase 1 100 7.3e-32 PFAM
Pfam:Kdo 3 77 8.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171300
SMART Domains Protein: ENSMUSP00000126036
Gene: ENSMUSG00000025538

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:FGE-sulfatase 34 299 3.9e-88 PFAM
Meta Mutation Damage Score 0.0918 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ser/Thr protein kinase family and encodes a protein with one protein kinase domain and two calmodulin-binding domains. This protein is the catalytic member of a 16 subunit protein kinase complex which contains equimolar ratios of 4 subunit types. The complex is a crucial glycogenolytic regulatory enzyme. This gene has two pseudogenes at chromosome 7q11.21 and one at chromosome 11p11.12. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Phkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Phkg1 APN 5 129865073 nonsense probably null
IGL01116:Phkg1 APN 5 129864972 splice site probably null
IGL01713:Phkg1 APN 5 129866873 missense probably benign 0.01
IGL02246:Phkg1 APN 5 129864638 missense probably damaging 0.97
IGL02803:Phkg1 APN 5 129866054 missense possibly damaging 0.95
IGL02954:Phkg1 APN 5 129866069 missense probably damaging 1.00
PIT4403001:Phkg1 UTSW 5 129865931 missense probably benign 0.02
R0041:Phkg1 UTSW 5 129874262 missense probably benign
R0140:Phkg1 UTSW 5 129864608 missense probably benign 0.01
R0321:Phkg1 UTSW 5 129869524 start codon destroyed probably null 1.00
R0646:Phkg1 UTSW 5 129864553 unclassified probably null
R1142:Phkg1 UTSW 5 129873232 missense possibly damaging 0.92
R1446:Phkg1 UTSW 5 129873214 critical splice donor site probably null
R2350:Phkg1 UTSW 5 129864532 missense probably damaging 1.00
R4773:Phkg1 UTSW 5 129873273 splice site probably null
R7236:Phkg1 UTSW 5 129866961 missense probably damaging 1.00
R7499:Phkg1 UTSW 5 129873268 nonsense probably null
R7658:Phkg1 UTSW 5 129865923 missense probably damaging 1.00
R7719:Phkg1 UTSW 5 129873858 start gained probably benign
Z1177:Phkg1 UTSW 5 129866255 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAGAAGTCCTCCTCCTCAG -3'
(R):5'- TTGCAGGGGATGTCAGCTAAC -3'

Sequencing Primer
(F):5'- TCCTCAGCCAAGGAGAGG -3'
(R):5'- AAATCCCTACAGATGCTTGTAGCCTG -3'
Posted On2015-01-23