Incidental Mutation 'R2896:Prss1'
ID260794
Institutional Source Beutler Lab
Gene Symbol Prss1
Ensembl Gene ENSMUSG00000062751
Gene Nameprotease, serine 1 (trypsin 1)
SynonymsTry-1, PRSS1, Trygn16, Try1
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41458932-41463786 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 41463705 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 238 (W238*)
Ref Sequence ENSEMBL: ENSMUSP00000031910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031910]
Predicted Effect probably null
Transcript: ENSMUST00000031910
AA Change: W238*
SMART Domains Protein: ENSMUSP00000031910
Gene: ENSMUSG00000062751
AA Change: W238*

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Tryp_SPc 23 239 9.87e-106 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Prss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Prss1 APN 6 41462711 missense possibly damaging 0.87
IGL00661:Prss1 APN 6 41462619 missense possibly damaging 0.90
IGL01780:Prss1 APN 6 41463205 missense probably damaging 0.96
IGL02350:Prss1 APN 6 41463205 missense probably damaging 0.96
IGL02357:Prss1 APN 6 41463205 missense probably damaging 0.96
R0090:Prss1 UTSW 6 41461232 missense probably benign 0.00
R0137:Prss1 UTSW 6 41462561 missense probably damaging 1.00
R0143:Prss1 UTSW 6 41463588 missense probably damaging 1.00
R0422:Prss1 UTSW 6 41463312 missense probably damaging 1.00
R0792:Prss1 UTSW 6 41458944 start codon destroyed probably null
R0939:Prss1 UTSW 6 41463588 missense probably damaging 1.00
R2762:Prss1 UTSW 6 41463281 missense possibly damaging 0.93
R2915:Prss1 UTSW 6 41462611 missense probably benign 0.11
R2959:Prss1 UTSW 6 41463238 missense probably damaging 0.99
R5123:Prss1 UTSW 6 41463197 missense possibly damaging 0.84
R5587:Prss1 UTSW 6 41463265 missense possibly damaging 0.57
R5610:Prss1 UTSW 6 41461213 missense probably benign 0.07
R6521:Prss1 UTSW 6 41463681 missense probably damaging 1.00
R6788:Prss1 UTSW 6 41463720 missense possibly damaging 0.46
R7199:Prss1 UTSW 6 41462756 missense probably damaging 1.00
R7552:Prss1 UTSW 6 41462573 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAGCCCTATTACACATGCC -3'
(R):5'- TGTTACCAGGGGCAGCCTC -3'

Sequencing Primer
(F):5'- ACATGCCCTTACTAATACACTGTG -3'
(R):5'- TTGACAGTGACTGCAGAG -3'
Posted On2015-01-23