Incidental Mutation 'R2896:Lcmt1'
ID260797
Institutional Source Beutler Lab
Gene Symbol Lcmt1
Ensembl Gene ENSMUSG00000030763
Gene Nameleucine carboxyl methyltransferase 1
SynonymsLCMT-1, Lcmt
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location123369784-123430358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123421586 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 245 (R245G)
Ref Sequence ENSEMBL: ENSMUSP00000033025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033025] [ENSMUST00000206574]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033025
AA Change: R245G

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033025
Gene: ENSMUSG00000030763
AA Change: R245G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:LCM 23 215 3.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206488
Predicted Effect probably benign
Transcript: ENSMUST00000206574
AA Change: R245G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are embryonic lethal. Mice homozygous for a hypomorphic gene trap allele exhibit partial embryonic lethality, insulin resistance and impaired glucose tolerance. Mice homozygous for a transgenic gene disruption exhibit kidney agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Lcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Lcmt1 APN 7 123428153 missense probably damaging 1.00
IGL01536:Lcmt1 APN 7 123422743 missense possibly damaging 0.46
IGL01564:Lcmt1 APN 7 123404440 missense probably benign 0.00
IGL02598:Lcmt1 APN 7 123421648 splice site probably benign
rancho UTSW 7 123401495 missense probably benign 0.03
relasso UTSW 7 123401468 missense probably damaging 1.00
R0665:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0668:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0943:Lcmt1 UTSW 7 123401439 splice site probably null
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R3017:Lcmt1 UTSW 7 123430136 missense probably damaging 1.00
R3547:Lcmt1 UTSW 7 123400479 missense probably benign 0.07
R3714:Lcmt1 UTSW 7 123404460 missense probably damaging 0.98
R4092:Lcmt1 UTSW 7 123418253 missense probably damaging 1.00
R4628:Lcmt1 UTSW 7 123410812 nonsense probably null
R5062:Lcmt1 UTSW 7 123410830 splice site probably null
R5096:Lcmt1 UTSW 7 123401468 missense probably damaging 1.00
R5549:Lcmt1 UTSW 7 123428107 missense probably damaging 1.00
R5573:Lcmt1 UTSW 7 123401463 missense probably benign 0.03
R5931:Lcmt1 UTSW 7 123421616 missense probably benign
R6331:Lcmt1 UTSW 7 123378182 intron probably benign
R7752:Lcmt1 UTSW 7 123369807 missense unknown
R7784:Lcmt1 UTSW 7 123401495 missense probably benign 0.03
RF013:Lcmt1 UTSW 7 123369836 frame shift probably null
RF025:Lcmt1 UTSW 7 123369834 frame shift probably null
RF046:Lcmt1 UTSW 7 123369834 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGTCACGTGTCCCACAAC -3'
(R):5'- GCGCACTGTAGGAAATGTTAAC -3'

Sequencing Primer
(F):5'- ACAACCTTCCCGGGCTG -3'
(R):5'- CGCACTGTAGGAAATGTTAACTTGTG -3'
Posted On2015-01-23