Incidental Mutation 'R2896:Abhd14b'
ID260798
Institutional Source Beutler Lab
Gene Symbol Abhd14b
Ensembl Gene ENSMUSG00000042073
Gene Nameabhydrolase domain containing 14b
Synonyms1810013B01Rik
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106447459-106452923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106450114 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 32 (R32C)
Ref Sequence ENSEMBL: ENSMUSP00000150885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024260] [ENSMUST00000048527] [ENSMUST00000048685] [ENSMUST00000171678] [ENSMUST00000171925] [ENSMUST00000185334] [ENSMUST00000185347] [ENSMUST00000185527] [ENSMUST00000185779] [ENSMUST00000185874] [ENSMUST00000186361] [ENSMUST00000187001] [ENSMUST00000187106] [ENSMUST00000190167] [ENSMUST00000190798] [ENSMUST00000213179] [ENSMUST00000214252] [ENSMUST00000215475] [ENSMUST00000215656] [ENSMUST00000216130] [ENSMUST00000216379] [ENSMUST00000217496]
Predicted Effect probably benign
Transcript: ENSMUST00000024260
SMART Domains Protein: ENSMUSP00000024260
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 4.15e-14 SMART
KH 100 171 1.47e-14 SMART
KH 240 310 3.24e-16 SMART
low complexity region 327 349 N/A INTRINSIC
low complexity region 364 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048527
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000038755
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 189 7.9e-18 PFAM
Pfam:Abhydrolase_6 35 141 2.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048685
SMART Domains Protein: ENSMUSP00000047322
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171678
SMART Domains Protein: ENSMUSP00000126101
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171925
SMART Domains Protein: ENSMUSP00000126916
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Abhydrolase_5 73 245 7.9e-17 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185334
SMART Domains Protein: ENSMUSP00000140345
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185347
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140279
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 183 7.6e-15 PFAM
Pfam:Abhydrolase_6 35 145 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185527
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139760
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 174 3.3e-14 PFAM
Pfam:Abhydrolase_6 35 144 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185779
SMART Domains Protein: ENSMUSP00000140629
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
KH 100 171 9.3e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185854
Predicted Effect probably benign
Transcript: ENSMUST00000185874
SMART Domains Protein: ENSMUSP00000141057
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186361
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141151
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 189 1.5e-17 PFAM
Pfam:Abhydrolase_6 35 145 5.1e-15 PFAM
Pfam:Abhydrolase_6 141 194 1.5e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186713
Predicted Effect probably benign
Transcript: ENSMUST00000187001
SMART Domains Protein: ENSMUSP00000140042
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1imja_ 51 110 1e-10 SMART
PDB:1IMJ|A 58 110 6e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187106
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139597
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 142 2.5e-9 PFAM
Pfam:Abhydrolase_6 35 141 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187975
Predicted Effect probably benign
Transcript: ENSMUST00000190167
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140655
Gene: ENSMUSG00000042073
AA Change: R32C

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 34 149 1.4e-9 PFAM
Pfam:Abhydrolase_6 35 147 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190798
SMART Domains Protein: ENSMUSP00000141096
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 1.7e-8 PFAM
Pfam:Abhydrolase_5 73 157 1.2e-8 PFAM
Pfam:Abhydrolase_6 74 157 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213179
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000214252
Predicted Effect probably benign
Transcript: ENSMUST00000215475
Predicted Effect probably benign
Transcript: ENSMUST00000215656
Predicted Effect probably benign
Transcript: ENSMUST00000216130
AA Change: R32C

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000216379
Predicted Effect probably benign
Transcript: ENSMUST00000217496
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Abhd14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1332:Abhd14b UTSW 9 106451996 missense probably damaging 1.00
R2895:Abhd14b UTSW 9 106450114 missense probably benign 0.01
R7258:Abhd14b UTSW 9 106450219 missense probably benign 0.00
R7384:Abhd14b UTSW 9 106450141 missense probably benign
R7769:Abhd14b UTSW 9 106451620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGATCCTCAAGGCCTGG -3'
(R):5'- AGATTGGCTAAATCCTTCCAGTC -3'

Sequencing Primer
(F):5'- GTGGACACCTAACTGCTCC -3'
(R):5'- GGCTAAATCCTTCCAGTCCTCCATC -3'
Posted On2015-01-23